Labshake search
Citations for Thermo Fisher :
1551 - 1600 of 10000+ citations for rno mir 125b 5p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... Real-time RT-PCR analysis was performed using a StepOnePlus System (Thermo Fisher Scientific) and THUNDERBIRD Next SYBR qPCR Mix reagents (TOYOBO ...
-
bioRxiv - Cell Biology 2024Quote: ... Quantitative RT-PCR was performed on QuantStudio 12 K Flex (Applied Biosystems, MA, USA) using a Platinum SYBR Green qPCR SuperMix-UDG (11733046 ...
-
bioRxiv - Cancer Biology 2024Quote: ... RT-qPCR was performed using SYBR Green PCR Master Mix (Cat# 4309155, Thermo Fisher). Amplification was carried out using the StepOne Real-Time PCR System (Cat# 4376357 ...
-
bioRxiv - Cell Biology 2024Quote: ... was used for RT-PCR amplification and detection was performed using ViiA7 (Life Technologies) or Step One Plus Real-Time PCR system(Applied Biolsystems) ...
-
bioRxiv - Cell Biology 2024Quote: ... RT-qPCR was performed in a StepOnePlus™ Real-Time PCR System (Applied BioSystems) using SYBR® Green JumpstartTM Taq Ready Mix (Merck) ...
-
bioRxiv - Immunology 2024Quote: ... RT-qPCR was performed using Power SYBR Green PCR Master Mix (Applied Biosystems 4367659) with appropriate primer sets on a QuantStudio 5 Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Microbiology 2024Quote: ... RT-qPCR was performed using the SYBR™ Green PCR Master Mix (ThermoFisher #4309155) and specific oligonucleotides for each targeted transcript (Table 3) ...
-
bioRxiv - Cancer Biology 2022Quote: ... cDNA was synthesized from 5 ng of total RNA using TaqMan® Small RNA Assays RT-primers (Thermo Fisher Scientific) with the High-Capacity cDNA Reverse Transcription Kit ...
-
bioRxiv - Physiology 2020Quote: ... and 0.5 μg of RNA was reverse transcribed with random hexamer primers using a High-Capacity cDNA RT kit (Applied Biosystems) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: Approximately 200 ng of extracted vRNA was reverse transcribed using a universal 3′ primer (5′-AGGGCTCTTCGGCCAGCRAAAGCAGG) and Superscript III reverse transcriptase (RT) (Invitrogen). The RT product was diluted approximately 10,000-fold and used as a template for quantitative PCR (qPCR) ...
-
bioRxiv - Cell Biology 2021Quote: ... The reverse transcription of 1 μg of total RNA was performed with 5x RT-buffer mix with M-MuLV- RH reverse transcriptase (Biolabmix) and random hexamer primer (Invitrogen) and diluted 1:10 in MilliQ H2O ...
-
bioRxiv - Plant Biology 2021Quote: ... cDNA was synthesized using DNA-free RNA with oligo-dT (20) primers and SuperScript III First-Strand Synthesis System for RT-qPCR (Invitrogen). After incubation at 50°C for 1 h and 70°C for 15 min ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA was synthesized from 1 μg of total RNA using oligo-dT primer and Superscript III reverse transcriptase (RT) in a 20 μl reaction (Invitrogen) according to the manufacturer’s instruction ...
-
bioRxiv - Immunology 2022Quote: ... then reverse transcribed into cDNA using a TSO primer (59-AAGCAGTGGTATCAACGCAGAGTACATrGrGrG-39) and RT maxima reverse transcriptase (Thermo Fisher Scientific). Amplification of cDNA was performed using an ISPCR primer (59-AAGCAGTGGTATCAACGCAGAGT39 ...
-
bioRxiv - Neuroscience 2021Quote: ... First-strand cDNA was synthesized from 2 µg of total RNA using oligo(dT) primer and Superscript IV reverse transcriptase (RT) according to the manufacturer’s instructions (Life Technologies). First-strand cDNA samples were diluted 1:3 and 5 µL was used as template ...
-
bioRxiv - Neuroscience 2019Quote: ... First-strand cDNA was synthesized from 2 micrograms of RNA using oligo(dT) primer and Superscript IV reverse transcriptase (RT) according to the manufacturer’s instructions (Life Technologies). First-strand cDNA samples were diluted 1:5 and 5 μl was used as template ...
-
bioRxiv - Immunology 2020Quote: ... 100 ng to 1 µg total RNA was subjected to reverse transcription using random primers and M-MLV RT (Invitrogen). Specific primer pairs for each gene were designed ...
-
bioRxiv - Genetics 2020Quote: ... First-strand cDNA was synthesized from 2 micrograms of RNA using oligo(dT) primer and Superscript IV reverse transcriptase (RT) according to the manufacturer’s instructions (Life Technologies). First-strand cDNA samples were diluted 1:10 and 5 μl was used as template ...
-
bioRxiv - Immunology 2022Quote: ... cDNA was synthesized using 1 ug of RNA reverse transcribed for 50 min at 42°C using oligo(dT) primer (IDT) and SuperScript II RT (Invitrogen). For qPCR analysis ...
-
bioRxiv - Microbiology 2022Quote: ... Extracted vRNA was reverse transcribed using a 1:1 ratio of universal influenza primers (53)(S2 Table) and Maxima RT (Thermofisher) per protocol instructions ...
-
bioRxiv - Genomics 2023Quote: ... 23 μL were mixed with reverse transcription master mix (1.25 μL of 10 μM scc primers, 10 μL Maxima RT buffer (ThermoFisher #EP0753), 5 μL dNTPs (New England Biolabs #N0447L) ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was converted to cDNA using multiplexed RT primers and High Capacity cDNA Reverse Transcription Kit (ThermoFisher; Carlsbad, CA). miRNAs were then quantified using individual TaqMan assays on an ABI QuantStudio 7 real time PCR machine (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2024Quote: ... RT-qPCR was performed with gene-specific primers (Supplemental Table S2) and the Fast SYBR green master mix (Applied Biosystems) using the QuantStudio 1 real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Biochemistry 2024Quote: ... Ten micrograms of total RNA was reverse transcribed (RT) at 37 °C using random hexamer primers and Moloney murine leukemia virus retrotranscriptase (Invitrogen-Life Technologies ...
-
bioRxiv - Plant Biology 2020Quote: ... Quantitative PCR was performed with specific primers (Table S1) using the QuantStudio™ 6 Flex Real-Time PCR System (ThermoFisher Scientific) and cycling conditions for PCR were 50°C for 2 min ...
-
bioRxiv - Neuroscience 2021Quote: ... we designed more than 2 pairs of PCR primers in the 5’ and 3’ untranslated regions and inserted all resulting PCR products into pCR-Blunt-TOPO vector (Thermo Fisher). The TOPO-transcript vectors of the same gene were sequenced and compared to verify that no error was introduced to the coding sequence during reverse transcription ...
-
bioRxiv - Microbiology 2022Quote: ... a DNA fragment comprising the sgRNA target region was amplified by PCR using primers AATAGAGCAAACAACAGGAGGC and GAGTACTGACCTGGTCCTTTGG and the Phusion Flash High-Fidelity PCR Master Mix (Thermo Scientific).
-
The formation of a fuzzy complex in the negative arm regulates the robustness of the circadian clockbioRxiv - Molecular Biology 2022Quote: ... PCR reactions using primers found in Table 1 were carried out using Phusion Flash High-Fidelity PCR Master Mix (ThermoFisher, F548S), following the manufacturer’s instructions and using an Eppendorf Mastercycler Nexus Thermal Cycler with the following program ...
-
bioRxiv - Genomics 2020Quote: ... were amplified via the polymerase chain reaction (PCR) using primers to facilitate subsequent ligation of the PCR products into the glutathione-S-transferase encoding vectors (Life Technologies). The M.MspI PCR product was initially inserted into the BamHI and EcoRI sites in pGEX 2T ...
-
bioRxiv - Cancer Biology 2024Quote: ... mRNA levels were quantified by quantitative real-time polymerase chain reaction (qRT-PCR) using the following PCR primers on a ABI PRISM 7900HT Sequence Detection System (Applied Biosystems). Primer sequences ...
-
bioRxiv - Microbiology 2024Quote: ... The resulting assembled amplicon was then selectively amplified in the second PCR reaction using outer primers of the homology arms and cloned into the pCR-Blunt vector using Zero Blunt PCR cloning kit (ThermoFisher Scientific). Repair templates produced by OE-PCR were ultimately used for transfections.
-
bioRxiv - Biochemistry 2023Quote: ... S4) respectively were PCR amplified by specific primers (Table S2) using Phusion® High-Fidelity PCR Master Mix (Thermo Fisher Scientific) from genomic DNA template and sub-cloned by restriction cloning into GFP expression plasmids pPD95_79 and pPD95_81 ...
-
bioRxiv - Bioengineering 2023Quote: ... The relative abundance of EV miRNA was determined by TaqMan PCR using TaqMan Universal PCR Master Mix II and TaqMan primers and probes from Applied Biosystems. hsa-miR-423-3p was used as an endogenous reference miRNA ...
-
bioRxiv - Immunology 2024Quote: ... was synthesized using T7 promoter-flanked PCR products generated by amplifying a Luciferase-containing plasmid with T7-flanked PCR primers with the MEGAscript RNAi kit (Life Technologies) (Supplementary Table 5) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Excess of primers and dNTPs were then removed using ExoSAP-IT PCR Cleanup Reagents (ThermoFisher). Samples (3 ng ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and PCR primers were used for bidirectional sequencing on a 3130xl Genetic Analyzer (Applied Biosystems). Sequences were edited using CodonCode Aligner (CodonCode Corporation ...
-
bioRxiv - Molecular Biology 2021Quote: ... with gene-specific primers using PowerUp SYBR Green PCR Master Mix (Thermo Fisher Scientific, USA). The details of the primers (sequences and annealing temperatures ...
-
bioRxiv - Immunology 2021Quote: ... with specific primers (Metabion) on an Applied Biosystems StepOne Real-Time PCR system (Applied Biosystems). Relative gene expression was calculated after normalization to β-actin transcriptional levels.
-
bioRxiv - Immunology 2021Quote: ... Gene expression was quantified with TaqMan real-time PCR primers (Thermo Fisher Scientific, Waltham, MA). The results were normalized against β-actin.
-
bioRxiv - Plant Biology 2020Quote: ... re-amplified by PCR with primers with attB tails and BP-cloned into pDONR207 (Invitrogen). Promoter:GUS binary vectors were generated by LR recombination using Gateway LR clonase II (Invitrogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... Primers (STable 2) and SYBR Green PCR Master Mix (Applied Biosystems by Life Technologies, TX) were used for q-PCR analysis using the StepOnePlus Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2021Quote: ... Primers (STable 2) and SYBR Green PCR Master Mix (Applied Biosystems by Life Technologies, TX) were used for q-PCR analysis using the StepOnePlus Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Cell Biology 2021Quote: ... carried out on a BioRad CFX96 Real-Time System using TaqMan PCR primers (ThermoFisher Scientific) according to manufacturer instructions using 50ug of cDNA per reaction ...
-
bioRxiv - Cell Biology 2022Quote: ... The qRT-PCR for mRNAs of interest was performed using gene-specific primers (Applied Biosystems), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Table S1) and all PCR primers were purchased from Thermo Fisher (Waltham, MA; Table S2). All protocols involving animals or using animal tissue have been approved by Brigham and Women’s Hospital Institution of Animal Care and Use Committee (IUCAC) ...
-
bioRxiv - Microbiology 2019Quote: ... Primer 2: 5’-GGATGTTCGTCCAGTGAGATTAG-3’) using a 7500 Fast Real-Time PCR System (Applied Biosystems) and accompanying software to analyze qPCR data.
-
bioRxiv - Microbiology 2021Quote: ... amplified with indicated primers using the Power SYBR Green PCR Master Mix (Thermo Fisher, # 4367659), and analyzed by QuantStudio 5 Real-Time PCR (Thermo Fisher) ...
-
bioRxiv - Pathology 2021Quote: ... housekeeping control Bm-tub primers were used with SYBR Green real-time PCR (Applied Biosystems) per manufacturer specifications (14).
-
bioRxiv - Cancer Biology 2020Quote: ... 150nM of each primer and 5 μl 2X-Jump Start SYBR Green PCR Mix (Invitrogen) in10 μl total volume ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 0.4 μM of primers using a QuantStudio 6 real-time PCR system (Applied Biosystems). All qPCR primers are listed in the dataset provided in Synapse database ...