Labshake search
Citations for Thermo Fisher :
1551 - 1600 of 10000+ citations for 1 Benzyl 3 Tert Butyldimethylsilyl Oxy Methyl Piperidin 4 One since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... at 1:200 and (4’,6-diamidino-2-phenylindole) DAPI (Fisher Scientific) at 1:10,000.
-
bioRxiv - Cell Biology 2021Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (1:1000) (Invitrogen, Thermo Fisher Scientific) was added to visualize cell nuclei ...
-
bioRxiv - Cell Biology 2021Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (1:1000) (Invitrogen, Thermo Fisher Scientific) was added to visualize cell nuclei ...
-
bioRxiv - Cancer Biology 2020Quote: ... Accutase was then diluted 1:4 in PBS−/− (Life Technologies #14190-250) and then pelleted (250g ...
-
bioRxiv - Microbiology 2020Quote: ... and mixed with 1 μL of FM 4-64 dye (Life Technologies) for 5 min on ice with gentle tapping of the tube ...
-
bioRxiv - Neuroscience 2020Quote: ... and 4’,6’-diamidino-2-phenylindole dihydrochloride (1 µg/ml, Life Technologies) for 2 hr ...
-
bioRxiv - Microbiology 2021Quote: ... using sulfosuccinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate reagent (ThermoFisher Scientific, USA) in accordance to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... or (4) anti-mouse coupled to Alexa Fluor555 (1:1000, Invitrogen, A21422), Phalloidin-coupled to Alexa Fluor 488 (1:1000 ...
-
bioRxiv - Neuroscience 2022Quote: ... On day 4 cells were passaged 1:2 with Stempro Accutase (Invitrogen) for 5 minutes at 37C and replated on hESC qualified Matrigel® ...
-
bioRxiv - Biophysics 2022Quote: ... Sulfosuccinimidyl-4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SSMCC) was purchased from ThermoFisher Scientific (Rockford ...
-
bioRxiv - Cancer Biology 2022Quote: ... heparin salt (4 ug/ml) and pen/strep (1% v/v) (Invitrogen) was used to culture the spheroids ...
-
bioRxiv - Cell Biology 2022Quote: ... DAPI was used (4’,6-Diamidino-2-Phenylindole, Dihydrochloride, 1:10,000, Invitrogen). For staining of lipid droplets ...
-
bioRxiv - Microbiology 2020Quote: ... 10 ml 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, Gibco), 24 mL 5% NaHCO3 (Gibco ...
-
bioRxiv - Bioengineering 2020Quote: ... with 4 mM L-glutamine and 1 mM sodium pyruvate (Life Technologies), N2 supplement (Life Technologies ...
-
bioRxiv - Immunology 2020Quote: ... The blood was diluted 1:4 in RPMI-1640-GlutaMAX-I (Gibco) and 1 ml of this solution was transferred to 24-well plates and stimulated with 0.05 or 0.1 ng/ ml of LPS in the presence or the absence of 5 nM of SARS-CoV-2 S protein ...
-
bioRxiv - Physiology 2020Quote: ... and DAPI (4’,6-diamidino-2-phenylindole, 1 μg ml1; ThermoFisher, #D1306) overnight at 4°C ...
-
bioRxiv - Physiology 2021Quote: ... 0.5 μL of 1 mM Fluo-4 AM calcium dye (Thermo Fisher) was added to each chamber of cells before incubation on the Zeiss Exciter confocal microscope stage at 37°C in humidified 5% CO2 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) were purchased from Gibco/Thermo Fisher Scientific (Grand Island ...
-
bioRxiv - Immunology 2021Quote: ... followed by 4 ng μL−1 goat-anti-mouse-AF488 (Thermo Scientific). Cells were resuspended in 1 mL FACSFlow buffer (BD Biosciences ...
-
bioRxiv - Microbiology 2021Quote: ... and counterstaining with DAPI (4’, 6-diamidino-2-phenylindole, ThermoFisher, 1:10000) and phalloidin (ThermoFisher ...
-
bioRxiv - Microbiology 2023Quote: ... 4’,6’-diamino-2-fenil-indol (1:25000) (DAPI, Life Technologies, USA) and Phalloidin (1:500 ...
-
bioRxiv - Microbiology 2023Quote: ... The 4’,6’-diamino-2-fenil-indol (DAPI) (1:2500, Life Technologies) and the Phalloidin (Alexa-488 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and DAPI (4, 6-diamidino-2-phenylindole dihydrochloride; Invitrogen, D1306, 1:500).
-
bioRxiv - Molecular Biology 2023Quote: ... at a 4:1 ratio PEI:DNA in Opti-MEM (Thermo Fisher Scientific). 24h later ...
-
bioRxiv - Microbiology 2023Quote: ... and 10.0 mL of 1:4 HCl (trace grade H1196; Fisher Scientific) was added and beakers were covered with a watch glass ...
-
bioRxiv - Molecular Biology 2022Quote: ... and passaged every 4-5 days with 1 mg/ml dispase (Gibco).
-
bioRxiv - Cancer Biology 2022Quote: ... and 4 μg of IgG (1:250, Cat#10500C, Thermo Fisher Scientific) antibodies and incubated overnight ...
-
bioRxiv - Bioengineering 2024Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, 1:5000; Invitrogen; Carlsbad, CA, USA) allowed visualization of cell nuclei ...
-
bioRxiv - Cell Biology 2024Quote: ... L-Glutamine (4 mM) and Sodium Pyruvate (1 mM) (Thermo Fisher, 11995065), supplemented with 10% Fetal Bovine Serum (FBS ...
-
bioRxiv - Neuroscience 2024Quote: ... at a 1:4 DNA:PEI ratio or Lipofectamine 2000 (Thermo Fisher Scientific). HEK293FT cells were seeded on 15-cm plates and co-transfected with packaging plasmids AAV-ITR-2 genomic vectors (7.5 µg) ...
-
bioRxiv - Neuroscience 2024Quote: ... and passaged every 4-5 days with 1 mg/ml Dispase (Gibco). The human FUSWT line ...
-
bioRxiv - Neuroscience 2023Quote: ... at a 1:4 DNA:PEI ratio or Lipofectamine 2000 (Thermo Fisher Scientific).
-
bioRxiv - Cancer Biology 2023Quote: ... heparin salt (4 µg /ml) and pen/strep (1% v/v) (Invitrogen). Spheroids were allowed to grow for 5-10 days before being counted by a blinded observer ...
-
bioRxiv - Biochemistry 2023Quote: ... plasmids at 4:1 ratio (by mass) using Lipofectamine 2000 (Invitrogen, 11668019) in Opti-MEM (Gibco ...
-
bioRxiv - Biophysics 2023Quote: ... the nucleus with 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen, 1:200), microtubules with an anti-tubulin antibody produced in mouse (1:200 ...
-
bioRxiv - Bioengineering 2023Quote: ... Calcium assay buffer (1 mL, Fluo-4 Direct calcium assay buffer, Invitrogen) was mixed with 77 mg of water-soluble probenecid (Invitrogen ...
-
bioRxiv - Developmental Biology 2023Quote: ... with DAPI (4’, 6-Diamidino-2-Phenylindole) (Life Technologies; D1306; 1:10,000). Images were captured using a Nikon Eclipse 80i system with the NIS-Elements BR software (version 4.3 ...
-
bioRxiv - Immunology 2024Quote: ... was mixed in 4:1 molar ratios with SA-Allophycocyanin (APC; Invitrogen) and SA phycoerythrin (PE ...
-
bioRxiv - Immunology 2024Quote: ... Molt-4 cells and yac-1 cells were cultured RPMI1640 (Gibco, USA) supplemented with 10% FBS ...
-
bioRxiv - Neuroscience 2024Quote: ... following which 4 μL of 1:125 diluted crimson FluoSpheres (Thermo Fisher) were added before back-side blotting and plunge freezing into liquid ethane at −185 °C using a GP2 (Leica Microsystems) ...
-
bioRxiv - Biophysics 2024Quote: ... the nucleus with 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen, 1:200), microtubules with an anti-tubulin antibody produced in mouse (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2024Quote: ... unfiltered human plasma from healthy participants collected into K2 EDTA anticoagulant was acquired from BIOIVT (HUMANPLK2-0000283) and diluted 1:4 in nuclease-free water (Invitrogen, AM9937). Plasma was spiked with DOR dilutions in DMSO for final DOR concentrations spanning 8 orders of magnitude matching the DOR-spiked buffer concentrations (10-3 M to 10-10 M) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES; Thermo Fisher Scientific), 1 × Glutamax ...
-
bioRxiv - Neuroscience 2020Quote: ... freshly mitochondria isolated from pupae were resuspended in respiration buffer (0.5 mg/ml) containing Tetramethylrhodamine methyl ester perchlorate (0.5 μM) (Thermo Fisher). The excitation spectra were scanned from 520 nm to 580 nm using 590 nm emission wavelengths ...
-
bioRxiv - Microbiology 2021Quote: ... and cells were overlayed with carboxy-methyl cellulose (CMC) containing media (0.6% CMC, MEM supplemented with 1X Penicillin/Streptomycin (Gibco), 2% FBS ...
-
bioRxiv - Biochemistry 2021Quote: ... The RBD/Legobody complex at 2.5mg/ml were incubated with MS(PEG)12 methyl-PEG-NHS-ester (Thermo Fisher) at a 1:25∼28 molar ratio for 2 hrs on ice ...
-
bioRxiv - Neuroscience 2022Quote: [Ca2+]c was measured by ratiometric analysis using acetoxy-methyl-ester Fura-2 (Fura-2/AM; F1221 Thermo Fisher) according to the manufacturer’s instructions ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Cell Biology 2020Quote: ... media was changed gradually into a gradient of (1/4) Neurobasal media (NB: based medium contained 1% Lglutamine, 1% N2 and 2% B27 (all from Invitrogen)) plus reduced gradient of (3/4 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Naïve hESCs were routinely passaged as single cells every 3 days at a ratio of 1:3 using TrypLE™ Express (1X) (Gibco, Thermo Fisher Scientific) and plated in fresh media supplemented with 10 μM of Y-27632 (Stemcell Technologies).