Labshake search
Citations for Thermo Fisher :
1451 - 1500 of 10000+ citations for 7H Cyclopenta c pyridin 7 one 5 6 dihydro 3 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... RNA purity was assessed using a NanoDrop One (ThermoFisher Scientific, ND-ONE-W). The RNA samples (1μg ...
-
bioRxiv - Microbiology 2022Quote: ... One infected and one uninfected flask were treated with DSS Crosslinker (Thermo Scientific) following manufacturer instructions for intracellular crosslinking ...
-
bioRxiv - Biophysics 2022Quote: ... RNA was then quantified using a Nano Drop One (Thermofisher #ND-ONE-W) and the concentration adjusted to 60 ng/uL ...
-
bioRxiv - Immunology 2023Quote: ... the IgG concentration was determined using NanoDrop One (Thermo Fisher, ND-ONE-W). All monoclonal antibodies were assessed for integrity by SDS-PAGE analysis.
-
bioRxiv - Physiology 2023Quote: ... One hundred microliters of One-step Ultra TMB ELISA substrate (Thermo Scientific #34028) was added to each well ...
-
bioRxiv - Cell Biology 2024Quote: ... Protein concentrations were determined using a NanoDrop One (Thermo Fisher, ND-ONE-W) using absorbance.
-
bioRxiv - Microbiology 2021Quote: ... qPCR was performed on QuantStudio 3 and 5 Real-Time PCR Systems (Thermo Fisher Scientific) based on the following cycling parameters ...
-
bioRxiv - Systems Biology 2019Quote: ... 5’-ACG UGA CAC GUU CGG AGA Att-3’) by Lipofectamine 2000 (Thermo Fisher, #11668019) 48 hr before performing experiment.
-
bioRxiv - Cell Biology 2019Quote: ... CAP-D3 (5-CAUGGAUCUAUGGAGAGUATT-3)29 and control15 were transfected using Oligofectamine transfection reagent (Invitrogen) according to the manufacturer’s instructions and analysed 48h after transfection ...
-
bioRxiv - Genetics 2019Quote: ... 5’ -6FAM CTC AGA GAC ATA TCA AAG ATT CCA GGG-MGB-3’ (Life Technologies). Viral load is expressed on a Log10 scale as viral genome copies per milliliter (plasma samples ...
-
Potassium channel-driven bioelectric signaling regulates metastasis in triple-negative breast cancerbioRxiv - Cancer Biology 2021Quote: ... CDH11 #4: 5’-CCUUAUGACUCCAUUCAAA-3’ using Lipofectamine RNAiMAX transfection reagent (13778030; ThermoFisher Scientific, Waltham, MA) in serum-free DMEM ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 mM EDTA) and settled for 3 min in a magnetic stand (Fisher scientific, #FERMR02). Beads were then resuspended in 1 volume of IP buffer and ready to use ...
-
bioRxiv - Molecular Biology 2022Quote: ... Grids were blotted for 3 - 5 s in a Vitrobot (Mark IV, Thermo Fisher Scientific) at 20 °C and 100% humidity ...
-
bioRxiv - Cell Biology 2022Quote: Control siRNA against Luciferase (siLuc) was custom ordered from Life technologies (sense: 5’-uaugcaguugcucuccagcdtdt-3’). Individual or pooled siRNAs against other targets were ordered from Horizon Discovery (Dharmacon) ...
-
bioRxiv - Cell Biology 2019Quote: ... for 5 min and separated on a 3-8% tris-acetate gel (ThermoFisher Scientific; EA0375BOX). Following electrophoresis ...
-
bioRxiv - Microbiology 2019Quote: ... Primer 2: 5’-GGATGTTCGTCCAGTGAGATTAG-3’) using a 7500 Fast Real-Time PCR System (Applied Biosystems) and accompanying software to analyze qPCR data.
-
bioRxiv - Synthetic Biology 2019Quote: ... and MIT_v2.1_SbfInifJ_RV2 5’-AACCTGCAGGGCTAACTAACTAACCACGGACAAAAAACC-3’) and ligated into pCR Blunt II TOPO (Thermo Fisher Scientific). The second half containing nifBQFUSVWZM was amplified with SbfI sites on either end (with oligos MIT_v2.1_SbfInifB_FW 5’-AACCTGCAGGTACTCTAACCCCATCGGCCGTCTTA-3’ ...
-
bioRxiv - Developmental Biology 2019Quote: For live imaging 3-5 day old flies were dissected in Schneider’s Insect Media (Thermofisher) supplemented with 10% Fetal Bovine Serum (FBS ...
-
bioRxiv - Genetics 2021Quote: ... 3×105 U2OS cells were incubated with 5 pmol siRNA using lipofectamine RNAiMAX (Thermo Fisher) in a 12-well tissue culture plate for 2hr ...
-
bioRxiv - Genomics 2021Quote: ... Erythrocytes were lysed by treatment with 3-5 mL ACK lysing buffer (Gibco, Cat#A1049201) for 5 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... London) were transiently transfected with the following antisense oligos: ROD1 (5′ GGAAUGAUAUUGAGCUGCUAACAAA 3′; ThermoFisher Scientific), TACC3 (5’ GAGCGGACCUGUAAAACUA 3’ ...
-
bioRxiv - Neuroscience 2023Quote: ... The neurons were then washed 3 times for 5 minutes with 1X DPBS (14080055, Gibco) containing 0.1% Tween ...
-
bioRxiv - Biophysics 2023Quote: ... the tissue was incubated for 5 min with 1 µM TO-PRO-3 iodide (Invitrogen, Life Technologies Corporation ...
-
bioRxiv - Microbiology 2023Quote: ... FungiQuant-Prb (6FAM) 5′-TGGTGCATGGCCGTT-3′ (MGBNFQ) 57 and QuantStudio3 instrument (Applied Biosystems, CA, USA). We used the following qPCR conditions ...
-
bioRxiv - Immunology 2023Quote: ... Fluorescence was measured using a QuantStudio 3 or QuantStudio 5 qPCR machine (Thermo Fisher Scientific).
-
bioRxiv - Immunology 2023Quote: ... 5 × 106 cells were cultured in 3 ml Dulbecco’s modified Eagle’s medium (DMEM) (Life Technologies) supplemented with 10% fetal bovine serum (Life Technologies).
-
bioRxiv - Neuroscience 2024Quote: ... 3-5 mm skin biopsies were collected in Biopsy Collection Medium (RPMI 1460 [Thermo Fisher] with 1X Antibiotic-Antimycotic [Thermo Fisher]) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Add pre-mix chewing solution (5 μl 10xNEBbuffer2.1, 3 μl 100 mM DTT (ThermoFisher, A39255), 2 μl 100 mM ATP (ThermoFisher ...
-
bioRxiv - Microbiology 2024Quote: ... homogenized and placed in sterile 5 mL Eppendorf tubes containing 3 mL of RNAlater (ThermoFisher). The tubes were stored at -20°C upon our arrival in the laboratory ...
-
bioRxiv - Bioengineering 2024Quote: ... Red blood cells were lysed with ACK Lysing Buffer (Gibco, 3 ml for 5 min). The cells were counted and resuspended in RPMI-1640 medium (Corning ...
-
bioRxiv - Genomics 2020Quote: ... Ligation reactions were transformed into One Shot™ Stbl3™ chemically-competent E.coli cells (42°C heat-shock, 90 seconds; Invitrogen C737303) and positive clones were selected by Sanger sequencing ...
-
bioRxiv - Genetics 2019Quote: Coverslips were incubated for one hour at 37°C in 1mL of of 1:30 solution of Collagen I Rat Protein (Thermo Fisher Scientific) to 1X PBS ...
-
bioRxiv - Biochemistry 2020Quote: ... Each well was washed with PBS and then incubated for one hour at 4°C while rocking with 1 mg/mL EZ-Link NHS-SS-Biotin (Thermo Fisher Scientific) in PBS ...
-
bioRxiv - Biochemistry 2023Quote: ... Reactions were performed at 37°C for one hour and stopped by the addition of LDS loading buffer containing β-mercaptoethanol (Invitrogen NP0007). Samples were heated for 10 min at 70 °C and loaded on 4-12% Bis-Tris (Invitrogen NP0323 ...
-
bioRxiv - Microbiology 2024Quote: ... Samples were eluted in 30 μL nuclease-free water pre-warmed at 50°C and quantified by NanoDrop One (Thermo Fisher Scientific).
-
bioRxiv - Biophysics 2024Quote: ... Fungal conidia were cultivated at 30°C for one week on the agar media prepared with 65 g/L YPD (Catalogue # DF0428175, Thermo Fisher Scientific) and pre-autoclaved ...
-
bioRxiv - Developmental Biology 2021Quote: ... cDNA was diluted 1: 25 and 6 µl was used for one qPCR reaction with PowerUp™ SYBR™ Green Master Mix (Thermo Fisher Scientific, A25776). Relative gene expression was calculated using the ΔΔCT method relative to ACTB control.
-
bioRxiv - Genomics 2023Quote: ... the ORF4-6 genomic region was amplified directly from the clinical samples using the SuperScript™ IV One-Step RT-PCR System (Thermo Fisher Scientific, Waltham, MA). Primers were designed using Primer3 (26 ...
-
bioRxiv - Genomics 2020Quote: ... Genomic PCR products obtained with primers 5’-CGCCATCAACTTCACCTAGC-3’ (forward) and 5’-TCTGGGAAGAAGTTTGGCCT-3’ (reverse) were sequenced using the BigDye® Terminator v1.1 Cycle Sequencing Kit (Thermo Fisher Scientific, Massachusetts, USA) on an ABI 3130xl Genetic Analyzer (Life Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... a probe prepared by PCR on genomic mouse DNA with the primers 5’-CATATTCCAGGTCCTTCAGTGTGC-3’ and 5’-CACTTTAGGACGTGAAAT ATGGCG-3’ was labeled with Cy3 by random priming according to the kit instruction (Invitrogen Kit, Ref 18095–011).
-
bioRxiv - Bioengineering 2021Quote: ... sgRNA LA93527 was generated from a PCR DNA template (overlapping primers LA935 5’-GAAATTAATACGACTCACTATAGGACAGTGCGGTCCG-CAAGGGTTTTAGAGCTAGAAA-3’ and LA137 5’-AAAAGCACCGACTCGGTGCCA-CTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3’) containing the T7 promoter using the MEGAscript T7 Transcription kit (ThermoFisher Scientific, Walthum, MA USA). The reaction mix was incubated at 37°C for 16 hours and purified using the MEGAclear Transcription Clean-Up kit (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... Dead cells were excluded using 7-AAD (7-Aminoactinomycin D, Thermo Fisher Scientific, 00-6993-50). Cells were analyzed using a FACSCanto II flow cytometer (BD ...
-
bioRxiv - Microbiology 2021Quote: ... denaturation for 2 min at 95 °C followed by 45 cycles of 3 s at 95 °C and 30 s 60 °C on the StepOnePlus™ Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). All samples were run in triplicate ...
-
bioRxiv - Molecular Biology 2021Quote: ... oligonucleotides from homologous regions D-ORF5 5′CCGctgagCAAGGTAGCCTCGTCTATTGGAC 3′ and R-ORF7 5′CCGctcgagTTCTTCATCTTCAATATTATGTC3′ were used using the PCR Reagent System Kit (Invitrogen, Life Technologies Inc.). The reaction mixture was prepared with l00 ng of recombinant TnGV DNA ...
-
bioRxiv - Biophysics 2021Quote: ... Protein samples (12 μL) were mixed with 3 μL 5 M DTT and 5 μL 4x NuPAGE™ LDS sample buffer (Thermo Fisher Scientific) and incubated (95 °C ...
-
bioRxiv - Biophysics 2023Quote: ... The grids were blotted for 3.5 s with 3 force after waiting for 5 s and immersed in liquid ethane using Vitrobot (Mark IV, Thermo Fisher Scientific/FEI) in condition of 100% humidity and 8°C.
-
bioRxiv - Biophysics 2023Quote: ... The grids were blotted for 5 s with 3 force after waiting for 5 s and immersed in liquid ethane using Vitrobot (Mark IV, Thermo Fisher Scientific/FEI) in condition of 100% humidity and 8°C.
-
bioRxiv - Immunology 2022Quote: Recombinant tri-S protein was heat-denatured at 100°C for 3 min in loading buffer (Invitrogen) containing 1X sample reducing agent (Invitrogen) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Immunoprecipitation was performed at 4°C for 3 hr with 50 µl protein G dynabeads (Thermo Fisher). Beads were washed five times with ice-cold Wash buffer 1 (50 mM Hepes-KOH (pH7.6) ...
-
bioRxiv - Cancer Biology 2020Quote: ... The aRNA was fragmented by incubating 3 min at 70 °C in Zn2+ RNA fragmentation reagents (Ambion) and purified with 2× volumes of SPRI beads ...