Labshake search
Citations for Thermo Fisher :
1251 - 1300 of 10000+ citations for 7H Cyclopenta c pyridin 7 one 5 6 dihydro 3 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Cells were passaged every 3-5 days as necessary using 0.5mM EDTA (Thermo Fisher). All staining and qPCR experiments included in Figure 1 were carried out in H1 and H9 stem cells ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5’ TCTTGCGGCTTTGTTGACAC 3’) using SYBR™ Green PCR Master Mix (Applied Biosystems, Bedford, MA). The quantities measured by real-time PCR were normalized to the Rpl13 (5’GGCGGACCGATTCAATAAGGTTCTGATCATTG 3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... The following siRNA target sequences were used: GTPBP5 siRNA: 5’-CGGUGGACACGUCAUUCUGTT-3’ (134621, Ambion); GTPBP7 siRNA ...
-
bioRxiv - Immunology 2024Quote: ... tonsils were rinsed 3 x 5 minutes with 1X PBS (10010023, ThermoFisher Scientific, USA) without agitation ...
-
bioRxiv - Genomics 2024Quote: ... and a QuantStudio 3 or QuantStudio 5 Real-Time PCR instrument (Applied Biosystems™). Primers used for qPCR are listed in Suppl ...
-
bioRxiv - Cell Biology 2024Quote: ... si-PRELID1: 5’-CCCGAAUCCCUAUAGCAAA-3’) were transfected using Lipofectamine RNAiMAX (Thermo Fisher Scientific, 13778075). Assays were normally carried out 48 h after transfection ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 7-AAD (Thermofisher Scientific) for 30min ...
-
bioRxiv - Developmental Biology 2021Quote: ... 7 (Applied Biosystems, Zug, Switzerland).
-
bioRxiv - Cancer Biology 2021Quote: ... 7-AAD (ThermoFisher Scientific, #A1310), AnnexinV-PE (BioLegend ...
-
bioRxiv - Cancer Biology 2022Quote: ... 7’-Dichlorofluorescin diacetate (DCFDA; Invitrogen). DCFDA is de-esterified into its fluorescent form after action of intracellular esterases and oxidation by reactive oxygen species within the cell (Ishii et al. ...
-
bioRxiv - Microbiology 2021Quote: ... MgCl2 (ThermoFisher AM9530G; 7 mM), and SmartScribe Reverse Transcriptase (TaKaRa 639538 ...
-
bioRxiv - Neuroscience 2021Quote: ViiA 7 system (Applied Biosystems)
-
bioRxiv - Cell Biology 2021Quote: ... 7’ dichlorofluorescein diacetate (DCFDA, Invitrogen at 37°C for 30 min ...
-
bioRxiv - Developmental Biology 2020Quote: Cos-7 cells (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... 7-AAD (Thermo Fisher Scientific) and Annexin-V PE (BD ...
-
bioRxiv - Biophysics 2022Quote: ... 7 kDa MWCO (Thermo Scientific). Terminase protomer was exchanged into a 200 mM ammonium acetate salt ...
-
bioRxiv - Developmental Biology 2023Quote: ... using 7-AAD (ThermoFisher Scientific) as a dead stain.
-
bioRxiv - Developmental Biology 2023Quote: ... using 7-AAD (ThermoFisher Scientific) as a dead cell stain ...
-
bioRxiv - Bioengineering 2024Quote: ... 7 kDa MWCO (Thermo Scientific). The extent of biotinylation was measured using the QuantTag Biotin Quantification kit (Vector Laboratories ...
-
bioRxiv - Genomics 2021Quote: ... Samples were transferred to 1.5 mL safe-lock tubes containing one scoop of acid-washed glass beads (<106μM) and 1 mL TRIzol (Invitrogen) containing 20μg/mL GenElute-LPA (Sigma-Aldricht ...
-
bioRxiv - Microbiology 2022Quote: ... One ml of fd or Pf4 phage (5 mg/ml) was incubated with 100 µg A488 fluorescent dye (ThermoFisher) for 1 hour at room temperature (RT ...
-
bioRxiv - Biochemistry 2022Quote: ... 5 mM EDTA) in the presence of one tablet of the protease inhibitor cocktail per 25 ml (Complete, Invitrogen). Cell lysates were analyzed by 12% SDS-PAGE for 80 min at 100 V (Mini-Protean Cell ...
-
bioRxiv - Developmental Biology 2021Quote: ... The retina was then transferred to a microcentrifuge tube and incubated for 7 minutes at 37°C with an activated papain dissociation solution (87.5 mM HEPES pH 7.0 (Thermo Fisher Scientific, cat. #15630080), 2.5 mM L-Cysteine (MilliporeSigma ...
-
bioRxiv - Microbiology 2021Quote: ... 7) and plunge-frozen at a condition of 95% humidity and 4°C by using a Vitrobot Mark IV (Thermo Fisher Scientific). The cryo-EM data were acquired with a Titan Krios at 300 kV (Thermo Fisher Scientific ...
-
bioRxiv - Pathology 2022Quote: ... All RNA extracts were eluted in 60 μL of diethyl pyrocarbonate (DEPC)-treated water for storage at −70°C prior to quantification and were tested in triplicate using an Applied Biosystems ViiA 7 RT-qPCR machine (Thermo Fisher Scientific). Viral RNA levels were calculated in RNA copies by comparing the average of each triplicate from a sample to the standard curve generated with each PCR plate ...
-
bioRxiv - Neuroscience 2019Quote: ... The washed pellet was either stored at −20 °C overnight or resuspended in 7-12 ml of inclusion body solubilization reagent (Thermo Scientific #78115). The protein suspension was shaken for 30-40 min at 20 °C and then ultracentrifuged at 35,000 x g for 20-30 min at 4 °C.
-
bioRxiv - Molecular Biology 2019Quote: ... The retina was then transferred to a microcentrifuge tube and incubated for 7 minutes at 37°C with an activated papain dissociation solution (87.5 mM HEPES pH 7.0 (Thermo Fisher Scientific, cat. #15630080), 2.5 mM L-Cysteine (MilliporeSigma ...
-
bioRxiv - Immunology 2023Quote: ... diluted to 2 μM in warm RPMI-1640 and incubated at 37°C for 30 min before washed and stained with 7-AAD (Invitrogen, cat # A1310).
-
bioRxiv - Bioengineering 2023Quote: ... Cryopreserved hiPSC-derived endothelial cells were thawed in a water bath at 37 °C and transferred into a 15 mL tube containing 7 mL of Human Endothelial SFM medium (11111044; Thermo Fisher Scientific). The cells were centrifuged at 300 x g for 3 min and the pellet was resuspended in Human Endothelial SFM complete medium ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were then dried at 100°C and derivatized with 7-chloro-4-nitrobenzo-2-oxa-1,3-diazole (Acros Organics, ThermoFisher Scientific) prior to reverse-phase HPLC (Agilent 1100 series ...
-
bioRxiv - Developmental Biology 2024Quote: ... incubated for 7 min at 37°C with proteinase K in PBST (1/2000 from a glycerol stock at 20mg/ml, Ambion, Cat#10259184), washed in PBST for 2×10 min at RT ...
-
bioRxiv - Biochemistry 2021Quote: ... Stained ovaries were finally mounted with one drop of vectashield in epoxy diagnostic slides (Thermo-Fisher Scientific, 3 wells 14 mm) and covered with high precision cover glasses ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The transfection reagent was mixed with the pOG44 Flp-Recombinase expression vector and the pCDNA5/TO/FRT-3xMyc-eGFP-CLIP-170 WT or one of the mutant vectors with a 3:1 ratio in Opti-MEMTM I medium (Gibco, ThermoFisher Scientific). Selection started 48h after the transfection in a Dulbecco’s modified Eagle medium (DMEM ...
-
bioRxiv - Physiology 2020Quote: ... interleukin 6 (IL-6; Invitrogen, Carlsbad, CA), plasminogen activator inhibitor 1 (PAI-1 ...
-
bioRxiv - Molecular Biology 2019Quote: ... 0.5 µg of RNA was heated for 5 min to 65°C and cDNA was generated using SuperScript III (Life Technologies) and random primers for 1 h at 50°C followed by heat inactivation for 15 min at 70°C ...
-
bioRxiv - Neuroscience 2021Quote: The successfully reprogrammed hiPSCs were incubated in hypoxic conditions (5% CO2, 5% O2) at 37°C and maintained in StemFlex™ media (Gibco) on 6-well NUNC™ plates (ThermoFisher ...
-
bioRxiv - Molecular Biology 2019Quote: HeLa cells grown on poly-L-lysine–coated coverslips were incubated in 5% CO2 at 37°C for 1 h with 5 µM MitoTracker Red CMXRos (Molecular Probes) in DMEM ...
-
bioRxiv - Cell Biology 2022Quote: Dictyostelium discoideum cells were maintained in Hans’ enriched HL-5 media (1.4X HL-5 media with 8% FM, penicillin and streptomycin) at 22°C in petri dishes (Fisher Scientific; FB0875712). A full list of strains used in this study can be found in Appendix Table S3.
-
bioRxiv - Plant Biology 2021Quote: ... two SlP4H3 OEX lines (#1, #2) and three SlP4H3 RNAi lines (#1, #6 and #7) by using the TRI reagent (Thermo Fisher Scientific, Waltham, MA, USA). Reverse transcription of approximately 1 μg of total RNA was performed with Superscript II® Reverse Transcriptase (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... with or without inhibitors at 4°C for 5 min and 37°C for 30 min in the presence of FM4-64FX (Thermo Fisher Scientific) to stain wounded cells ...
-
bioRxiv - Neuroscience 2022Quote: ... 72°C for 5 minutes and then held at 4°C in a Veriti™ 96-well thermal cycler (Applied Biosystems™). Adaptors from the LSK-109 sequencing kit (Nanopore ...
-
bioRxiv - Neuroscience 2022Quote: ... supplemented with 5% Fetal Bovine Serum (FBS), 4°C) and incubated (37°C, 2 minutes) in protease solution (TrypLE express, Thermo Fisher 12604013) supplemented with DNase (100 U/ml ...
-
bioRxiv - Cancer Biology 2022Quote: ... The oligos were annealed in a thermocycler with gradual T reduction from 95°C to 25°C at a rate of 5°C/min and subsequently diluted 1:20 into Nuclease free water (ThermoFisher Scientific AM9938). The pLentiCRISPRv2 plasmid was digested for 1 hr at 55°C with 1U per μg of DNA BsmBI-v2 (NEB ...
-
bioRxiv - Immunology 2023Quote: ... into the reaction mix and incubating it at 37 °C for 15 min and 98 °C for 5 min in the Veriti Thermal Cycler (Applied Biosystems, USA). Quantitative analysis of IL-6 and IFNB expression in THP1 dual reporter cells was performed by StepOne Real-Time PCR Systems (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2019Quote: ... Forty cycles of qPCR were performed with 60°C annealing temperature and 30 second extension time using a Step-One-Plus qPCR machine (Applied Biosystems). CT values were determined using StepOne software ...
-
bioRxiv - Neuroscience 2021Quote: Freshly dissected retinas were incubated with gentle agitation for one hour at 37°C in 1 mg/mL of pHrodo Red-conjugated zymosan bioparticles (ThermoFisher Scientific) resuspended in retinal culture media (1:1 mixture of DMEM and F-12 supplemented with L-glutamine ...
-
bioRxiv - Plant Biology 2021Quote: ... qRT-PCR was performed using c-DNA synthesized from one μg of total RNA with oligo-dT using First Strand cDNA synthesis kit (Invitrogen, USA) according to manufacturer’s instructions and PCR amplification was done using gene specific primers.
-
bioRxiv - Neuroscience 2022Quote: ... Membranes were blocked in TBS-T/5% BSA for one hour at RT and incubated overnight at 4 °C with anti-CD63 (TS63) (1:500, #10628D, Life Technologies), anti-CD171 (L1CAM ...
-
bioRxiv - Molecular Biology 2021Quote: ... overnight at 4 °C on rotation and for one additional hour with mixed Dynabead protein G and A (20:10 µl, Life Technologies). Beads were washed with TSE- 150 (0.1% SDS,1% Triton ...
-
bioRxiv - Physiology 2023Quote: ... We kept the chamber at 26.5 ± 2.5 °C with one of two stirring hot plates (Thermolyne, model: SP18425; Fisher Scientific, model: SPN105082). After a 1 h familiarisation period with the chamber ...