Labshake search
Citations for Thermo Fisher :
1451 - 1500 of 10000+ citations for 2 4 Methyl 5 thiazolyl ethyl decanoate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... the washing medium was removed and 80 L of 5 M cell permeant Fluo-4 AM (Life technologies) in neurobasal medium was added to wells at room temperature and incubated at 37 °C for 30 minutes ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 4 mM DTT and 20% glycerol) at 30 °C in a Cytation 5 imaging reader (Thermo Fisher Scientific) with filters for excitation at 360/40 nm and emission at 460/40 nm ...
-
bioRxiv - Bioengineering 2020Quote: ... WT-PGP1 were labeled with 5 μM CellTracker™ Blue 7-amino-4-chloromethylcoumarin CMAC (Molecular Probes, #C2110), iNeuron-PGP1 was labeled with 2.5 μM CellTracker™ Green CMFDA (Molecular Probes ...
-
bioRxiv - Cell Biology 2021Quote: ... 5-10µg of protein per sample was run on a 4%–12% NuPAGE Bis-Tris Gel (ThermoFisher Scientific) and then transferred to PVDF membrane by liquid transfer using NuPAGE Transfer buffer (ThermoFisher Scientific) ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 minutes) at 4 °C and re-suspended in media composed of Minimal Essential Medium (MEM, Life Technologies) with 10%/vol fetal bovine serum (Omega) ...
-
bioRxiv - Immunology 2023Quote: ... at 95°C for 5 min and separated on a 4-12% Bis-Tris gel (NuPAGE, Thermo Scientific) for 60 min at 170V ...
-
bioRxiv - Immunology 2023Quote: ... 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT) substrate (Thermo Fisher Scientific, cat.: 34042) was added and the reaction was terminated after 5 min under running tap water ...
-
bioRxiv - Microbiology 2023Quote: ... 4 g/L dextrose, 5.957 g/L HEPES, 0.05 g/L hypoxanthine, 5 g/L Albumax II, Invitrogen) supplemented with 200 mM L-glutamine ...
-
bioRxiv - Neuroscience 2023Quote: ... incubated for 5 min at 95°C and loaded onto a NuPAGE 4-12% Tris/Bis gel (ThermoFisher) with NuPAGE MOPS running buffer (ThermoFisher) ...
-
bioRxiv - Neuroscience 2022Quote: ... Samples were boiled for 5 minutes then electrophoresed in pre-cast 4-12% NuPAGE Bis-Tris Gels (Invitrogen). Following transfer ...
-
bioRxiv - Developmental Biology 2022Quote: ... centrifuged at 500xg for 5 min at 4°C and resuspended in 1% BSA in PBS (AM2616, Invitrogen) containing 200 U/μl RNase inhibitor (3335402001 ...
-
bioRxiv - Biochemistry 2024Quote: ... Samples were further lysed via sonication (10 sec on 5 sec off, repeat 3x, ThermoFisher: FB120, 4°C) and protein was clarified by centrifugation at 21,000 x g for 5 min at 4°C ...
-
bioRxiv - Bioengineering 2023Quote: Protein samples (5 µg protein) were mixed with either 4 x LDS sample buffer (Thermo-Fisher Life Technologies) or 4x LDS sample buffer + 50 mM dithiothreitol for SDS-PAGE analysis under non-reducing or reducing conditions ...
-
bioRxiv - Genomics 2023Quote: ... then heated at 100°C for 5 minutes and loaded onto a 4-12% polyacrylamide gel (ThermoFisher NP0322). Transfer onto a PVDF membrane was performed in 1X NuPage Transfer Buffer (ThermoFisher NP00061 ...
-
bioRxiv - Immunology 2022Quote: ... The cells were centrifuged at 400 g for 5 min at 4°C and resuspended in DPBS (GIBCO) supplemented with 5% FBS ...
-
bioRxiv - Cell Biology 2022Quote: ... 5–10mg of protein per sample was run on a 4–12% NuPAGE Bis-Tris Gel (ThermoFisher Scientific) and then transferred to PVDF membrane by liquid transfer using NuPAGE Transfer buffer (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2024Quote: ... Membranes were washed 4 times before staining for 5 minutes with Pierce ECL Western Blotting Substrate (Thermo Fisher) as per the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... cells were resuspended in 100 µL of PBS containing 5 µg/mL FM™ 4-64 (Molecular Probes). After incubation for 5 min at room temperature in the dark ...
-
bioRxiv - Microbiology 2024Quote: ... cells were resuspended in 100 µL of PBS containing 5 µg/mL FM™ 4-64 (Molecular Probes). After incubation for 5 min at room temperature in the dark ...
-
bioRxiv - Synthetic Biology 2024Quote: ... cells were incubated with 5 µM Fluo-4 AM and 0.02% Pluronic F-127 (Thermo Fisher Scientific, P3000MP) in a buffer solution for 30 minutes at 37°C ...
-
bioRxiv - Immunology 2024Quote: ... Cells were spun at 500G at 4°C for 5 minutes and resuspended in RNAlater ICE (Invitrogen AM7030).
-
bioRxiv - Microbiology 2024Quote: ... Gametocyte cultures were seeded from asexual blood stage cultures at 2% parasitaemia and 4% haematocrit in gametocyte medium (RPMI-1640 with 5% human AB+ serum, 0.5% Albumax, 3.7% 100xHT supplement (ThermoFisher), 30 mg/ml L-glutamine ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were resuspended in 400µL of freeze buffer (50 mM Tris-HCl pH 8.0, 40% glycerol, 5 mM MgCl2, 0.5 mM DTT, 4 u/mL RNase inhibitor [SUPERaseIN, Invitrogen]) and stored at -80°C.
-
bioRxiv - Molecular Biology 2020Quote: ... The tryptic peptides were loaded at 5 μL/min onto a C18 trap column (Thermo Scientific, 100 µm ID×2 cm, 5 μm, 120 Å). Peptides were separated with PicoFrit columns (New Objective ...
-
bioRxiv - Systems Biology 2020Quote: ... Disulfide bonds were reduced with 5 mM Tris(2-carboxyethyl)phosphine (TCEP) Bond-breaker (Thermo Scientific) at RT for 1 hr ...
-
bioRxiv - Cell Biology 2020Quote: ... protected by an Acclaim PepMap C18 column (100 μm x 2 cm, 5 μm; Thermo Scientific) before injection into a Q-Exactive mass spectrometer (ThermoFisher) ...
-
bioRxiv - Microbiology 2020Quote: ... The precolumn was a 2 cm EASYcolumn (ID 100 µm, 5 µm particles) (Thermo Fisher Scientific) while the analytical column was a 10 cm EASY-column (ID 75 µm ...
-
bioRxiv - Developmental Biology 2021Quote: ... The eggs were then loaded with the calcium indicator Fura-2 AM (5 μM; Thermo Fisher) for 30 min in KSOM containing 0.02% pluronic F-127 (Thermo Fisher) ...
-
bioRxiv - Neuroscience 2020Quote: ... the drinking water contained thymidine analogue EdU (5-ethynyl-2’-deoxyuridine, Thermo Fisher, cat. no: E10415) to label newly-generated cells ...
-
Control of cortical cytoskeleton-membrane interaction by RhoA regulates peripheral nerve myelinationbioRxiv - Neuroscience 2021Quote: ... the Click-iT EdU (5-ethynyl-2’-deoxyuridine) Alexa Fluor (AF) 568 imaging kit (Molecular Probes) was used in accordance with the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... 20 μl RNase A/T1 mix (2 μg μl−1 / 5 U μl−1, Thermo Scientific) was added to 100 μl lysate (OD260 ~ 150 ...
-
bioRxiv - Neuroscience 2020Quote: ... injection of EdU (5-ethynyl-2’-deoxyuridine; Click-it EdU Alexa Fluor 488 imaging kit, Invitrogen) at 5 and 6 days DPD at 50 mg/kg ...
-
bioRxiv - Neuroscience 2020Quote: ... The water contained 1 mg/mL 5-ethynyl-2-deoxyuridine (EdU) (Thermo Fisher Scientific, Cat. # E10187) and 1% sucrose ...
-
bioRxiv - Immunology 2020Quote: ... washed 2 × 100μL with complete RPMI and stained with 5 nM TMRE (T669, Thermo Fisher Scientific) in 200 μL complete RPMI at RT for 20 min ...
-
bioRxiv - Physiology 2021Quote: ... 1-2 µg of vector DNA was mixed with 5 µl of Lipofectamine™ (Thermo Fisher) in OPTIMEM-I media (GIBCO ...
-
bioRxiv - Molecular Biology 2020Quote: ... Primer extension was performed with 2 pmol of DNA gene-specific primers (5’CATGCTTAACGTAATTCAACAGAAATTATATG) by Invitrogen SuperScript III reverse transcriptase ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR detection of SARS-CoV-2 was performed on a QuantStudio 5 instrument (Applied Biosystems) using a TaqPath 1-step RT-qPCR Master Mix (Applied Biosystems ...
-
bioRxiv - Zoology 2020Quote: ... After 2 h and 30 min we added 5 μM dihydrorhodamine-123 (DHR) (Thermo Fisher Scientific) to the cell suspension to stain cells positive for reactive oxygen species (ROS ...
-
bioRxiv - Genomics 2021Quote: ... followed by 2 x 5 min washes in PBS before mounting in Prolong Diamond (Life Technologies).
-
bioRxiv - Immunology 2020Quote: T cells (5×106) from triplicates of 2 independent experiments were lysed in TRIzol reagent (ThermoFisher). Total RNA was isolated per manufacturer’s instruction and resuspended in RNase free water ...
-
bioRxiv - Immunology 2020Quote: Mice were injected intraperitoneally with 0.5 mg 5-ethynyl-2’-deoxyuridine (EdU, Invitrogen or Sigma-Aldrich). For pulse experiments ...
-
bioRxiv - Developmental Biology 2023Quote: The medusae were incubated with 150 μM 5-ethynyl-2’-deoxyuridine (EdU) (EdU kit; Invitrogen, C10337) in ASW for 1 h or 24 h ...
-
bioRxiv - Cell Biology 2023Quote: ... TMT reaction was allowed for 2 hours and quenched with 5% hydroxylamine (90115, Thermo Fisher Scientific). All the samples were pooled and dried in a SpeedVac (EP022822993 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 μg of sgRNA plasmid was transfected to PLC/PRF/5 cells using Lipofectamine 3000 (Invitrogen). After 2 days’ culture in DMEM medium ...
-
bioRxiv - Bioengineering 2022Quote: ... RBC (5 million cells/mL) were incubated with 2 μg/mL calcein AM (Thermo Fisher Scientific) for 15 minutes at 37°C ...
-
bioRxiv - Neuroscience 2024Quote: ... Cells were loaded with Fura-2 AM at 1 μg/mL (108964-32-5, Life Technologies) in HBSS or Fluo-4 AM at 10 μM in (ThermoFisher ...
-
bioRxiv - Developmental Biology 2023Quote: ... mice were injected intraperitoneally with 2.5 mg of 5-ethynyl- 2’-deoxyuridine (EdU; Thermo Fisher Scientific). Lungs were harvested ...
-
bioRxiv - Genomics 2023Quote: ... for 2 h and with 33 nM C12FDG (5-Dodecanoylaminofluorescein Di-β-D-Galactopyranoside; ThermoFisher D2893) for 1 h ...
-
bioRxiv - Immunology 2023Quote: ... added to 2 μL of TruCut Cas9 Protein v2 (5 ng/μL, Thermo Fisher Scientific A36498), and incubated for 10 minutes at room temperature ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... per liter] and 20% glycerol on an SM/5 agar media [2 g glucose (Fisher Scientific), 2 g yeast extract (Oxoid) ...