Labshake search
Citations for Thermo Fisher :
1401 - 1450 of 10000+ citations for Human Immunodeficiency Virus Tat Protein HIV 1 Clade D UG28R since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... Virus stocks used in vivo were produced by two passages on Vero E6 cells in DMEM (Gibco) without FBS ...
-
bioRxiv - Microbiology 2021Quote: ... Wild-type mumps virus (MuVi/Utrecht.NLD/40.10; genotype G) was grown on Vero cells in DMEM (Gibco) with 2% FBS ...
-
bioRxiv - Cancer Biology 2020Quote: ... Plasmid transfection and virus infection: Expression constructs were transfected into cells using Lipofectamine 2000 Transfection Reagent (Invitrogen) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... The genomic titer of each virus was determined by quantitative PCR using the ABI 7700 (Applied Biosystems) and primers specific to the WPRE ...
-
bioRxiv - Immunology 2020Quote: ... Virus detection was performed using One-Step RT-PCR SuperScript(tm) III Platinum(tm) Kit (Life Technologies). Thermal cycling was achieved at 55°C for 10 minutes for reverse transcription ...
-
bioRxiv - Cancer Biology 2020Quote: ... HEK293T cells (ATCC) were cultured for virus production in Dulbecco’s Modified Eagle Medium: Nutrient Mixture (DMEM) (GIBCO) supplemented with 10% FBS and 1% P/S ...
-
bioRxiv - Microbiology 2022Quote: ... and plasmids encoding two vaccinia virus capping enzyme subunits (pCAG-D1R and pCAG-D12L −0.8μg each) using 16μL Lipofectamine 2000 (Invitrogen) per transfection reaction in a total volume of 200μL of Opti-MEM (Gibco) ...
-
bioRxiv - Neuroscience 2022Quote: ... iPSC lines were generated using the Sendai virus (CytoTuneTM-iPS 2.0 Sendai Reprogramming Kit, Thermo Fisher Scientific) carrying the Yamanaka reprogramming factors OCT3/4 ...
-
bioRxiv - Neuroscience 2023Quote: Expanded PBMCs were transduced Sendai virus reprogramming vector – according to CytoTune® 2.0 Sendai (Thermo Fisher Scientific). Before cells infection ...
-
bioRxiv - Neuroscience 2023Quote: ... medium containing virus was processed by centrifugation (Sorvall WX-90 Ultracentrifuge and SureSpin 630 rotor; ThermoFisher Scientific), using a sorbitol cushion (20% sorbitol ...
-
bioRxiv - Microbiology 2023Quote: ... Presence of each virus strain in the supernatant was determined by PCR using Taq polymerase (Thermo Scientific) and 20 μL reactions containing 1 μL of virus supernatant ...
-
bioRxiv - Genetics 2023Quote: ... The PBMCs were reprogrammed by using Sendai virus (CytoTuneTM-iPS 2.0 Sendai Reprogramming kit, Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... purified gRNA from benzonase-treated virus material was treated with DNaseI (Thermo Fisher Scientific, Waltham, MA, USA), and analyzed using an Agilent 2100 bioanalyzer (Agilent Technologies ...
-
bioRxiv - Bioengineering 2023Quote: ... reverse transcription was performed with random hexamers and Moloney murine leukaemia virus (M-MLV) reverse transcriptase (Invitrogen). Synthesized RNA was used as a standard (BEI) ...
-
bioRxiv - Biochemistry 2023Quote: ... This virus mixture was used to infect 1.8–2.4 liters of High Five cells (Thermo Fisher Scientific) at a cell density of 3 × 106 per ml for 60 h at 27°C ...
-
bioRxiv - Microbiology 2023Quote: ... Infectious virus was reconstituted by transfecting ARPE-19 cells with BAC DNA and Lipofectamine 3000 (ThermoFisher L3000001); high titer stocks generated after three passages in ARPE-19 cells were used for this project ...
-
bioRxiv - Cell Biology 2023Quote: ... from a cDNA library of HCT116 which was prepared using Moloney murine leukemia virus reverse transcriptase (Invitrogen), as described previously (Ninagawa et al. ...
-
bioRxiv - Microbiology 2023Quote: ... cells were washed twice with PBS and then incubated with virus suspended in infectious medium (DMEM; Invitrogen) supplemented with 35% bovine serum albumin (BSA ...
-
bioRxiv - Biochemistry 2023Quote: ... virus was harvested by collecting supernatant and filtering it through 0.45µm PES sterile filter (Thermo Fisher, 2954545). Virus was concentrated by ultracentrifugation with a 20% sucrose cushion ...
-
bioRxiv - Microbiology 2024Quote: ... half of the virus supernatant after the concentration step was digested with amplification grade DNAse I (Invitrogen/Thermo Fisher Scientific ...
-
Resolution of SARS-CoV-2 infection in human lung tissues is driven by extravascular CD163+ monocytesbioRxiv - Immunology 2024Quote: ... cells were infected with virus diluted in 10 mL of Opti-MEM (ThermoFisher Scientific, Waltham, MA, USA) and incubated for 1 h at 37°C to allow for virus adsorption ...
-
bioRxiv - Molecular Biology 2024Quote: ... HEK293T cells used for the production of virus were cultured in DMEM supplemented with 2mM glutamine (Gibco), 10% Tetracycline-free FBS (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2024Quote: ... and the virus was incubated with 25 μg of Alexa Fluor 488 NHS Ester (succinimidyl ester; Invitrogen) for 1 hour at 25°C ...
-
bioRxiv - Microbiology 2024Quote: Genomic DNA was extracted from 1010 virus particles using the PureLink TM Genomic DNA mini kit (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... protein concentrations were determined by Bradford Protein Assay protein using Coomassie protein assay reagent (Thermo Fisher Scientific-Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: Primary human vein endothelial cells (HUVECs) were cultured in human endothelial SFM medium (Invitrogen) containing 20% foetal bovine serum ...
-
bioRxiv - Cell Biology 2020Quote: ... Human CD4+ T cells were activated by Dynabeads Human T-Activator CD3/CD28 (ThermoFisher) and cultured in AIMV medium (ThermoFisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... Slides were then incubated with Alexa 594 goat-anti rabbit secondary antibody at 1:750 and with Alexa Fluor 488 goat anti-human IgG(H+L) at 1:500 (both Invitrogen; in PBS) for 2 h at RT.
-
bioRxiv - Neuroscience 2019Quote: ... iPSCs were cultured on a feeder layer of irradiated mouse embryo fibroblasts using human embryonic stem cell media containing DMEM with F12 (DMEM/F12, 1:1 ratio, Thermo Fisher Scientific) supplemented with 20% Knockout Serum Replacer (Thermo Fisher Scientific) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Mouse lung fibroblasts (CCL-206, ATCC, Wesel, Germany) or human lung fibroblasts (MRC5, ATCC, CCL-171) were cultured in 1:1 DMEM (Gibco, MD, USA) and Ham’s F12 (Lonza ...
-
bioRxiv - Microbiology 2020Quote: ... The cells were washed three times with PBS and then incubated with either goat anti-human IgG conjugated with Alexa fluor 488 at a dilution of 1:500 for 1 h (Invitrogen, Carlsbad, CA). The cells were then washed and stained with hoechest-33342 (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... 2 million cells were activated with dynabeads human T activator CD3/CD28 at a 1:1 bead to cell ratio (Thermo Fisher Scientific), Staphylococcal enterotoxin B (SEB ...
-
bioRxiv - Immunology 2023Quote: ... highly purified (93-98%) naïve human CD4 T cells were activated using anti-CD3+anti-CD28 Dynabeads (1:1, Thermofisher scientific, cat # 11161D) for 8-24 hours ...
-
bioRxiv - Cell Biology 2024Quote: ... The following primary antibodies were used (all at 1:100 dilution in immunofluorescence, 1:1000 in immunoblots): CX36 mouse anti-human (Invitrogen, clone 1E5H5), rabbit recombinant ANTI-FLAG M2 antibody (Invitrogen 710662) ...
-
bioRxiv - Cancer Biology 2024Quote: Primary T-cells (CD4 and CD8; 1:1 ratio) were activated for 24 hours with Dynabeads™ Human T-Expander CD3/CD28 (Thermo Fisher) at 3:1 bead ...
-
bioRxiv - Bioengineering 2021Quote: ... + 2% human serum albumin (ThermoFisher) + 5 μM ROCKi (Tocris) ...
-
bioRxiv - Cell Biology 2020Quote: ... Human GR-specific siRNA (Invitrogen) was used at a concentration of 100 nM for 48 h to effectively knock down GR ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human primary melanocytes (Life Technologies) were grown in Medium 254 (Gibco ...
-
bioRxiv - Microbiology 2019Quote: ... including human 293FT cells (Invitrogen), rat2 cells (ATCC #CRL-1764) ...
-
bioRxiv - Physiology 2019Quote: ... human GDF15 (Hs00171132_m1 - ThermoFisher Scientific), human GAPDH (Hs02758991_g1 – ThermoFisher Scientific) ...
-
bioRxiv - Physiology 2019Quote: ... human GAPDH (Hs02758991_g1 – ThermoFisher Scientific), mouse HPRT (Forward – AGCCTAAGATGAGCGCAAGT ...
-
bioRxiv - Bioengineering 2021Quote: ... recombinant human Vitronectin (Gibco A14700) was used at a final concentration of 25ug/ml ...
-
bioRxiv - Cancer Biology 2020Quote: Human recombinant IL-1β (ThermoFisher) was reconstituted in deionised water and administered at 10 ng/ml.
-
bioRxiv - Cell Biology 2021Quote: ... human FMR1 (Ambion, USA, 4392420) and human ATF4 (Ambion ...
-
bioRxiv - Molecular Biology 2022Quote: ... AlexaFluor633 anti-human (all ThermoFisher) used 1:2000 in PBS with 0.2% BSA ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human CD11b-APC (Thermo Fisher); Human CD34-PE (Miltenyi Biotec);and Human CD33-APC-Cy7 (Abcam).
-
bioRxiv - Microbiology 2020Quote: ... and anti-human SPIB (Invitrogen) antibodies by incubating for 45 minutes at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: Human epidermal keratinocytes (HEKs, Thermofisher), and patient keratinocytes ...
-
bioRxiv - Cancer Biology 2019Quote: ... Human Epidermal Melanocyte cells (Invitrogen) were cultured in Medium 254 (Invirogen ...
-
bioRxiv - Developmental Biology 2019Quote: ... and recombinant human FGF2 (Invitrogen) at 20 ng/ml ...