Labshake search
Citations for Thermo Fisher :
1501 - 1550 of 10000+ citations for Human Immunodeficiency Virus Tat Protein HIV 1 Clade D UG28R since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: Genomic DNA was extracted from 1010 virus particles using the PureLink TM Genomic DNA mini kit (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... half of the virus supernatant after the concentration step was digested with amplification grade DNAse I (Invitrogen/Thermo Fisher Scientific ...
-
Resolution of SARS-CoV-2 infection in human lung tissues is driven by extravascular CD163+ monocytesbioRxiv - Immunology 2024Quote: ... cells were infected with virus diluted in 10 mL of Opti-MEM (ThermoFisher Scientific, Waltham, MA, USA) and incubated for 1 h at 37°C to allow for virus adsorption ...
-
bioRxiv - Neuroscience 2023Quote: Expanded PBMCs were transduced Sendai virus reprogramming vector – according to CytoTune® 2.0 Sendai (Thermo Fisher Scientific). Before cells infection ...
-
bioRxiv - Neuroscience 2023Quote: ... medium containing virus was processed by centrifugation (Sorvall WX-90 Ultracentrifuge and SureSpin 630 rotor; ThermoFisher Scientific), using a sorbitol cushion (20% sorbitol ...
-
bioRxiv - Microbiology 2023Quote: ... Presence of each virus strain in the supernatant was determined by PCR using Taq polymerase (Thermo Scientific) and 20 μL reactions containing 1 μL of virus supernatant ...
-
bioRxiv - Genetics 2023Quote: ... The PBMCs were reprogrammed by using Sendai virus (CytoTuneTM-iPS 2.0 Sendai Reprogramming kit, Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... purified gRNA from benzonase-treated virus material was treated with DNaseI (Thermo Fisher Scientific, Waltham, MA, USA), and analyzed using an Agilent 2100 bioanalyzer (Agilent Technologies ...
-
bioRxiv - Bioengineering 2023Quote: ... reverse transcription was performed with random hexamers and Moloney murine leukaemia virus (M-MLV) reverse transcriptase (Invitrogen). Synthesized RNA was used as a standard (BEI) ...
-
bioRxiv - Biochemistry 2023Quote: ... This virus mixture was used to infect 1.8–2.4 liters of High Five cells (Thermo Fisher Scientific) at a cell density of 3 × 106 per ml for 60 h at 27°C ...
-
bioRxiv - Microbiology 2023Quote: ... Infectious virus was reconstituted by transfecting ARPE-19 cells with BAC DNA and Lipofectamine 3000 (ThermoFisher L3000001); high titer stocks generated after three passages in ARPE-19 cells were used for this project ...
-
bioRxiv - Cell Biology 2023Quote: ... from a cDNA library of HCT116 which was prepared using Moloney murine leukemia virus reverse transcriptase (Invitrogen), as described previously (Ninagawa et al. ...
-
bioRxiv - Microbiology 2023Quote: ... cells were washed twice with PBS and then incubated with virus suspended in infectious medium (DMEM; Invitrogen) supplemented with 35% bovine serum albumin (BSA ...
-
bioRxiv - Biochemistry 2023Quote: ... virus was harvested by collecting supernatant and filtering it through 0.45µm PES sterile filter (Thermo Fisher, 2954545). Virus was concentrated by ultracentrifugation with a 20% sucrose cushion ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was reverse transcribed using the Moloney Murine Leukemia Virus Reverse Transcriptase Kit (Thermo Fisher Scientific, #28025013) with random hexamers (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... protein concentrations were determined by Bradford Protein Assay protein using Coomassie protein assay reagent (Thermo Fisher Scientific-Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: Primary human vein endothelial cells (HUVECs) were cultured in human endothelial SFM medium (Invitrogen) containing 20% foetal bovine serum ...
-
bioRxiv - Cell Biology 2020Quote: ... Human CD4+ T cells were activated by Dynabeads Human T-Activator CD3/CD28 (ThermoFisher) and cultured in AIMV medium (ThermoFisher ...
-
bioRxiv - Bioengineering 2021Quote: ... + 2% human serum albumin (ThermoFisher) + 5 μM ROCKi (Tocris) ...
-
bioRxiv - Cell Biology 2020Quote: ... Human GR-specific siRNA (Invitrogen) was used at a concentration of 100 nM for 48 h to effectively knock down GR ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human primary melanocytes (Life Technologies) were grown in Medium 254 (Gibco ...
-
bioRxiv - Microbiology 2019Quote: ... including human 293FT cells (Invitrogen), rat2 cells (ATCC #CRL-1764) ...
-
bioRxiv - Physiology 2019Quote: ... human GDF15 (Hs00171132_m1 - ThermoFisher Scientific), human GAPDH (Hs02758991_g1 – ThermoFisher Scientific) ...
-
bioRxiv - Physiology 2019Quote: ... human GAPDH (Hs02758991_g1 – ThermoFisher Scientific), mouse HPRT (Forward – AGCCTAAGATGAGCGCAAGT ...
-
bioRxiv - Bioengineering 2021Quote: ... recombinant human Vitronectin (Gibco A14700) was used at a final concentration of 25ug/ml ...
-
bioRxiv - Cancer Biology 2020Quote: Human recombinant IL-1β (ThermoFisher) was reconstituted in deionised water and administered at 10 ng/ml.
-
bioRxiv - Cell Biology 2021Quote: ... human FMR1 (Ambion, USA, 4392420) and human ATF4 (Ambion ...
-
bioRxiv - Molecular Biology 2022Quote: ... AlexaFluor633 anti-human (all ThermoFisher) used 1:2000 in PBS with 0.2% BSA ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human CD11b-APC (Thermo Fisher); Human CD34-PE (Miltenyi Biotec);and Human CD33-APC-Cy7 (Abcam).
-
bioRxiv - Microbiology 2020Quote: ... and anti-human SPIB (Invitrogen) antibodies by incubating for 45 minutes at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: Human epidermal keratinocytes (HEKs, Thermofisher), and patient keratinocytes ...
-
bioRxiv - Cancer Biology 2019Quote: ... Human Epidermal Melanocyte cells (Invitrogen) were cultured in Medium 254 (Invirogen ...
-
bioRxiv - Developmental Biology 2019Quote: ... and recombinant human FGF2 (Invitrogen) at 20 ng/ml ...
-
bioRxiv - Immunology 2021Quote: Human iPS cells (Thermo Fisher) were cultured on vitronectin-coated T225cm2 flasks using complete mTesSR Plus medium (StemCell Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... human COT1 DNA (Invitrogen, 15279011) and Vysis CEP hybridization buffer (Abbott Molecular ...
-
bioRxiv - Immunology 2020Quote: ... Human Expi293 cells (Thermo Scientific) were transfected with these constructs using FectoPro (PolyPlus Transfection ...
-
bioRxiv - Neuroscience 2021Quote: Human iPSCs (Thermo Fisher #A18945) were maintained in mTeSR1 medium (StemCell ...
-
bioRxiv - Immunology 2022Quote: ... APRIL Human ELISA Kit (ThermoFisher) and Human CD83 DuoSet ELISA Kit (R&D systems) ...
-
bioRxiv - Neuroscience 2022Quote: ... and human ACTB (Thermofisher Hs01060665_g1). For other qPCRs ...
-
bioRxiv - Microbiology 2023Quote: ... human Gas6 (Invitrogen, cat# BMS2291), mouse Axl (Abcam ...
-
bioRxiv - Neuroscience 2022Quote: ... Human primary astrocytes (ThermoFisher #N7805200) were maintained as described in user manual ...
-
bioRxiv - Molecular Biology 2024Quote: ... human COT1 DNA (#15279011, Invitrogen) and 3 volumes of ethanol (#10000652 ...
-
bioRxiv - Immunology 2024Quote: ... or anti-human (Invitrogen #A11013) secondary antibodies at 20 μg/mL in PBS/2% BSA for 30 min ...
-
bioRxiv - Systems Biology 2023Quote: ... and human IgE-PE (ThermoFisher). Antibody details are shown in Table S4 ...
-
bioRxiv - Genomics 2023Quote: ... human p53 (Invitrogen, PA5-27822), MDM2 (Santa Cruz Biotechnology ...
-
bioRxiv - Cancer Biology 2023Quote: ... human IFN-gamma ELISA (Invitrogen) and granzyme B ELISA (R&D Systems ...
-
bioRxiv - Physiology 2023Quote: ... Human GR-specific siRNA (Invitrogen) was used at a concentration of 100 nM for 48 h to effectively knockdown GR ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-human CD235a (#17998742, Invitrogen), anti-human CD326 (EpCAM ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-human CD45 (#17945942, Invitrogen), anti-human CD235a (#17998742 ...
-
bioRxiv - Cancer Biology 2024Quote: Recombinant human EGF (Gibco #PHG0311) was added to the medium of NCI-H23 or H23 KO cells at 80% confluency to reach a final concentration of 100 ng/mL ...