Labshake search
Citations for Thermo Fisher :
1301 - 1350 of 10000+ citations for Mouse NXPE4 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... mouse-anti-mouse/human/rat monoclonal PP1a (1:1000 dilution, number MA5-17239, ThermoFisher Scientific), rabbit-anti-Y.pestis polyclonal YopM (1:1000 dilution ...
-
bioRxiv - Immunology 2024Quote: ... and mouse monoclonal antibody to mouse IFNβ (Clone: MAR1-5A3) were obtained from Thermo Scientific. BHA (Cat# B1253 ...
-
bioRxiv - Cell Biology 2024Quote: ... Alexa Fluor 350 goat anti-mouse and Alexa Fluor 488 goat anti-mouse IgG (Invitrogen).
-
bioRxiv - Cell Biology 2023Quote: ... Alex Fluor 647 goat anti-mouse and Alexa Fluor 594 goat anti-mouse from Invitrogen. All secondary antibodies were used at a concentration of 1:500 ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse monoclonal anti 6xHis (mouse monoclonal, HIS.H8, Thermo Fisher Scientific, MA1-21315; WB 1:2000), anti GFP (mouse monoclonal ...
-
bioRxiv - Genomics 2023Quote: ... EY.T434 mouse embryonic fibroblast cells mouse embryonic fibroblast cells were grown in DMEM (ThermoFisher 10566016) supplemented with 15% (vol/vol ...
-
bioRxiv - Cell Biology 2024Quote: ... Alexa 594 goat anti-mouse/rat (1:1000, Invitrogen A-11032 mouse, A-11007 rat) and DAPI (1:500 ...
-
bioRxiv - Cell Biology 2019Quote: ... plasmids were transiently expressed with Lipofectamine 2000 or 3000 (Invitrogen) per manufacturer’s instructions.
-
bioRxiv - Cell Biology 2020Quote: Plasmid transfection with Lipofectamine 3000 (Thermo Fisher Scientific, Waltham, MA) was conducted 48 h after brown adipocytes were induced to differentiate ...
-
bioRxiv - Cell Biology 2020Quote: ... The plasmid containing SAR1 was transfected with Lipofectamine 2000 (Invitrogen) following the manufacturer’s recommendations into HEK293T cells at 50% confluence the day of transfection along with lentiviral packaging plasmids pVSVg (3.5 µg ...
-
bioRxiv - Cell Biology 2020Quote: ... transient transfections of plasmids were performed using Lipofectamine 2000 (Invitrogen) and cells were assayed 72 h post-transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... and then cloned into the pENTR Gateway plasmid system (Invitrogen). The Entry plasmids were then recombined using the Gateway recombination cloning system (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... Plasmid DNA was transfected with Lipofectamine 2000 (Thermo Fisher Scientific) in U2OS cells according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Plasmids were transiently transfected with Lipofectamine 2000 (Thermo Fisher Scientific) according to the instruction of the manufacturer or with 10 mM PEI (Polyethylenimine ...
-
bioRxiv - Cell Biology 2020Quote: ... we used mito-mCitrine plasmid with TurboFect (ThermoFisher Scientfic, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... The donor plasmid was assembled by MultiSite Gateway cloning (Invitrogen) and contained a GFP transcription unit under the control of the 3xP3 promoter enclosed within two reversible ϕC31 attP recombination sequences flanked both 5′ and 3′ by 2 kb sequence amplified using primer 29113 ex5 B1 f (CAACCAAGTAGTTACTGTGCTC ...
-
bioRxiv - Microbiology 2019Quote: ... we digested plasmids using EcoRI (Invitrogen™ Anza Restriction Enzyme). For the hCYTB484 assay ...
-
bioRxiv - Molecular Biology 2021Quote: All plasmids were transfected using Lipofectamine 2000 (Life Technologies, 11668019) according to the manufacturer’s protocol.
-
bioRxiv - Developmental Biology 2020Quote: ... and plasmid DNA were diluted in Opti-MEM (31985070, Gibco) to a final DNA:Lipofectmine ratio of 1:3 and incubated at room temperature for 5 minutes ...
-
bioRxiv - Biochemistry 2022Quote: ... Control plasmids from ProQuest™ two-hybrid system (Life Technologies). Co-transformation with empty prey vector was used as negative control ...
-
bioRxiv - Neuroscience 2021Quote: ... All plasmids were grown in DH5a competent cells (Life Technologies) and purified using endotoxin-free maxiprep kits (Qiagen).
-
bioRxiv - Molecular Biology 2020Quote: ... PRF reporter plasmid DNAs were transfected using Lipofectamine 2000 (ThermoFisher) according to the manufacturers’ instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmid concentrations were measured using a Nanodrop (Thermo Fisher Scientific).
-
bioRxiv - Molecular Biology 2020Quote: ... and 260 ng pMD.G envelope plasmid using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2022Quote: ... Transfections were performed with purified plasmids using lipofectamine 2000 (Invitrogen) (with a ratio of 1 µg DNA ...
-
Rab35 Governs Apicobasal Polarity Through Regulation of Actin Dynamics During Sprouting AngiogenesisbioRxiv - Developmental Biology 2022Quote: ... PShuttle-CMV plasmids were then digested overnight with MssI (ThermoFisher) and Linearized pShuttle-CMV plasmids were transformed into the final viral backbone using electrocompetent AdEasier-1 cells (gift from Bert Vogelstein ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were selected for plasmid integration with geneticin (G418, ThermoFisher). MDCK Claudin-quintuple knockout (Cldn-qKO ...
-
bioRxiv - Microbiology 2020Quote: ... Minipreps were done using GeneJET Plasmid Miniprep Kit (Thermo Scientific) and quantified by NanoDrop ...
-
bioRxiv - Cancer Biology 2020Quote: The plasmid DNA was quantified using a NanoDrop spectrophotometer (Thermofisher), all the preps were adjusted to the same concentration of 25 ng/μl ...
-
bioRxiv - Cell Biology 2019Quote: ... plasmid DNA was prepared in OptiMEM (Cat.# 31985070, Thermo Fisher). To produce virus for STEMCCA expression ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were transfected with LacR plasmid using Lipofectamine 2000 (Invitrogen) for 48 hrs ...
-
bioRxiv - Developmental Biology 2019Quote: ... A pCS2vegfcCDS plasmid was produced using Gateway LR clonase (Invitrogen). Capped mRNA was transcribed from a Not1-linearised template using the mMessage mMachine Kit (Ambion).
-
bioRxiv - Synthetic Biology 2019Quote: ... coli cultures using the PureLink Quick Plasmid Miniprep Kit (ThermoFisher). Input PCR products were purified using the GeneJet PCR purification kit (ThermoFisher) ...
-
bioRxiv - Biochemistry 2019Quote: ... mESCs were transfected with plasmid vectors using Lipofectamine 2000 (Invitrogen) and then seeded at low density on dishes coated with feeder cells ...
-
bioRxiv - Cancer Biology 2020Quote: ... for plasmids and Lipofectamine RNAiMAX Transfection Reagent (Thermo Fisher Scientific) for siRNA ...
-
bioRxiv - Neuroscience 2019Quote: ... Plasmids were amplified using DH5α competent cells (Thermo Fisher Scientific) and purified with Endofree plasmid maxi kit (Qiagen).
-
bioRxiv - Cancer Biology 2019Quote: ... DNA plasmids were transfected into Oneshot Stbl3 Competent Cells (Invitrogen) using the heat shock method ...
-
bioRxiv - Microbiology 2019Quote: ... and ligated into the plasmid vector pCRII-TOPO (Invitrogen, USA) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... The SUMO sequence was amplified from the petSUMO plasmid (Invitrogen) by PCR with Q5 polymerase (NEB ...
-
bioRxiv - Genomics 2021Quote: ... packaging plasmids using Lipofectamine LTX with Plus Reagent (Thermo Fisher). The standard culture medium was replaced after 12 h by culture medium with 30% FCS ...
-
bioRxiv - Systems Biology 2021Quote: ... plasmids were transfected using Lipofectamine LTX with PLUS™ (Invitrogen). Transfections were performed in 12-well plates with ~80% cell confluency at transfection ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The modified plasmid (pUG015) was digested with BglII (ThermoFisher, FD0083) and Gibson Assembly (NEB ...
-
bioRxiv - Cancer Biology 2020Quote: Residual plasmid DNA was removed using DNaseI (Amplification Grade, Invitrogen) according to the manufacturer’s protocol from 600 ng of the extracted RNA ...
-
bioRxiv - Biochemistry 2021Quote: ... Plasmid libraries were purified using GeneJet Maxi Prep kit (ThermoFisher).
-
bioRxiv - Neuroscience 2021Quote: ... These plasmids were transformed in Stbl2 competent cells (Thermo Fisher) to prevent recombination with bacterial DNA due to the repetitive sequences of the lentiviral backbones.
-
bioRxiv - Neuroscience 2021Quote: The plasmid was made using the Gateway system (ThermoFisher, 12538120) with combinations of entry and destination plasmids as follows ...
-
bioRxiv - Neuroscience 2020Quote: ... siRNA and plasmids were transfected with Lipofectamine 2000 (ThermoFisher Scientific) following manufacturer’s instruction.
-
bioRxiv - Cell Biology 2021Quote: ... Plasmid transfection was performed using Lipofectamine 3000 (Invitrogen, L3000-008) according to the manufacturer’s specifications ...
-
bioRxiv - Cancer Biology 2020Quote: ... Plasmids (1 μg) were diluted in 1 ml OptiMem (Gibco) and 20 μl PEI (1mg/ml ...
-
bioRxiv - Cell Biology 2021Quote: ... DNA plasmids were dispersed in opti-MEM (Gibco, 31985-047) and Fugene HD was added to the mix (ratio DNA:Fugene equals 1:3) ...