Labshake search
Citations for Thermo Fisher :
1201 - 1250 of 10000+ citations for Mouse NXPE4 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... goat anti-mouse (Invitrogen 32430); rabbit monoclonal c-MYC (Cell Signaling Technology ...
-
bioRxiv - Immunology 2023Quote: ... Anti-mouse actin (mAbGEa, ThermoFisher) was used 1:5000 1 h RT in 5% milk TBST ...
-
bioRxiv - Neuroscience 2024Quote: ... and goat anti-mouse (Invitrogen).
-
bioRxiv - Cancer Biology 2024Quote: ... mouse EGF (Gibco, Jenks, OK) was added 10 minutes prior to harvesting protein lysates from treated tumor cell lines to assess the impact of upstream receptor tyrosine kinase activation of RAS-MAPK/AKT signaling.
-
bioRxiv - Cell Biology 2024Quote: ... mouse anti-TFR (#136800, Invitrogen), rabbit anti-TFR (#ab84036 ...
-
bioRxiv - Cell Biology 2024Quote: ... 647 anti-mouse (Life Technologies, Cat ...
-
bioRxiv - Developmental Biology 2024Quote: ... donkey anti-mouse 488 (Invitrogen), and donkey anti-rabbit 594 (Invitrogen ...
-
bioRxiv - Neuroscience 2024Quote: ... or mouse Aif1 (Thermo Fisher Scientific FAM TaqMan 2X Universal Master Mix ...
-
bioRxiv - Immunology 2023Quote: ... Mouse: anti-CD19 PerCP (Invitrogen), anti-F4/80 PerCP (Invitrogen) ...
-
bioRxiv - Immunology 2021Quote: ... or pMK-RQ (EtIMP1Cit) plasmid with appropriate restriction enzyme sites for cloning into pYD1 yeast display plasmid vector (Invitrogen, Thermofisher Scientific, Waltham, MA, USA). A NotI restriction site was included between each antigen sequence and the 3’citrine tag ...
-
bioRxiv - Immunology 2020Quote: ... 1 × 105 cells were transfected with the appropriate plasmid combinations or plasmid/siRNA combinations using the Neon Transfection System (Thermo Fisher, Waltham, MA, USA) and a 10 µL Neon tip at 1000 V ...
-
bioRxiv - Immunology 2022Quote: ... 12μg heavy chain plasmid and 12 μg of light chain plasmid were added into 3ml of Opti-MEM™ (Thermo Fisher Scientific cat.# 31985070), after inverting ...
-
bioRxiv - Immunology 2023Quote: ... Sequence-verified Cas9-gRNA-Puro plasmids and pMA donor plasmid were co-transfected into in-house C57BL6/N 6.0 ESC using Lipofectamine 2000 (Thermo Fisher Scientific, Waltham, MA, USA) prior to selection with 2 μg/ml puromycin for 48 hours ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were transfected with 100 ng/well of either TOP luciferase reporter plasmid or the negative control FOP plasmid using Lipofectamine™ LTX Reagent with PLUS™ Reagent (Invitrogen, Carlsbad, US) in serum-free Opti-MEM® medium (Life Technologies ...
-
bioRxiv - Cancer Biology 2024Quote: ... Retrovirus was generated by transfecting oncogenic plasmids and viral packaging plasmid (pCL-Ampho) into phoenix cells with Lipofectamine 2000 (Life Technologies, Grand Island, NY). Viral particles were incubated with prostate cells (70% confluence ...
-
bioRxiv - Cell Biology 2019Quote: ... plasmids were transiently expressed with Lipofectamine 2000 or 3000 (Invitrogen) per manufacturer’s instructions.
-
bioRxiv - Cell Biology 2020Quote: Plasmid transfection with Lipofectamine 3000 (Thermo Fisher Scientific, Waltham, MA) was conducted 48 h after brown adipocytes were induced to differentiate ...
-
bioRxiv - Cell Biology 2020Quote: ... The plasmid containing SAR1 was transfected with Lipofectamine 2000 (Invitrogen) following the manufacturer’s recommendations into HEK293T cells at 50% confluence the day of transfection along with lentiviral packaging plasmids pVSVg (3.5 µg ...
-
bioRxiv - Cell Biology 2020Quote: ... transient transfections of plasmids were performed using Lipofectamine 2000 (Invitrogen) and cells were assayed 72 h post-transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... and then cloned into the pENTR Gateway plasmid system (Invitrogen). The Entry plasmids were then recombined using the Gateway recombination cloning system (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... Plasmid DNA was transfected with Lipofectamine 2000 (Thermo Fisher Scientific) in U2OS cells according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Plasmids were transiently transfected with Lipofectamine 2000 (Thermo Fisher Scientific) according to the instruction of the manufacturer or with 10 mM PEI (Polyethylenimine ...
-
bioRxiv - Cell Biology 2020Quote: ... we used mito-mCitrine plasmid with TurboFect (ThermoFisher Scientfic, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... The donor plasmid was assembled by MultiSite Gateway cloning (Invitrogen) and contained a GFP transcription unit under the control of the 3xP3 promoter enclosed within two reversible ϕC31 attP recombination sequences flanked both 5′ and 3′ by 2 kb sequence amplified using primer 29113 ex5 B1 f (CAACCAAGTAGTTACTGTGCTC ...
-
bioRxiv - Microbiology 2019Quote: ... we digested plasmids using EcoRI (Invitrogen™ Anza Restriction Enzyme). For the hCYTB484 assay ...
-
bioRxiv - Molecular Biology 2021Quote: All plasmids were transfected using Lipofectamine 2000 (Life Technologies, 11668019) according to the manufacturer’s protocol.
-
bioRxiv - Developmental Biology 2020Quote: ... and plasmid DNA were diluted in Opti-MEM (31985070, Gibco) to a final DNA:Lipofectmine ratio of 1:3 and incubated at room temperature for 5 minutes ...
-
bioRxiv - Biochemistry 2022Quote: ... Control plasmids from ProQuest™ two-hybrid system (Life Technologies). Co-transformation with empty prey vector was used as negative control ...
-
bioRxiv - Neuroscience 2021Quote: ... All plasmids were grown in DH5a competent cells (Life Technologies) and purified using endotoxin-free maxiprep kits (Qiagen).
-
bioRxiv - Molecular Biology 2020Quote: ... PRF reporter plasmid DNAs were transfected using Lipofectamine 2000 (ThermoFisher) according to the manufacturers’ instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmid concentrations were measured using a Nanodrop (Thermo Fisher Scientific).
-
bioRxiv - Molecular Biology 2020Quote: ... and 260 ng pMD.G envelope plasmid using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2022Quote: ... Transfections were performed with purified plasmids using lipofectamine 2000 (Invitrogen) (with a ratio of 1 µg DNA ...
-
Rab35 Governs Apicobasal Polarity Through Regulation of Actin Dynamics During Sprouting AngiogenesisbioRxiv - Developmental Biology 2022Quote: ... PShuttle-CMV plasmids were then digested overnight with MssI (ThermoFisher) and Linearized pShuttle-CMV plasmids were transformed into the final viral backbone using electrocompetent AdEasier-1 cells (gift from Bert Vogelstein ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were selected for plasmid integration with geneticin (G418, ThermoFisher). MDCK Claudin-quintuple knockout (Cldn-qKO ...
-
bioRxiv - Microbiology 2020Quote: ... Minipreps were done using GeneJET Plasmid Miniprep Kit (Thermo Scientific) and quantified by NanoDrop ...
-
bioRxiv - Cancer Biology 2020Quote: The plasmid DNA was quantified using a NanoDrop spectrophotometer (Thermofisher), all the preps were adjusted to the same concentration of 25 ng/μl ...
-
bioRxiv - Cell Biology 2019Quote: ... plasmid DNA was prepared in OptiMEM (Cat.# 31985070, Thermo Fisher). To produce virus for STEMCCA expression ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were transfected with LacR plasmid using Lipofectamine 2000 (Invitrogen) for 48 hrs ...
-
bioRxiv - Developmental Biology 2019Quote: ... A pCS2vegfcCDS plasmid was produced using Gateway LR clonase (Invitrogen). Capped mRNA was transcribed from a Not1-linearised template using the mMessage mMachine Kit (Ambion).
-
bioRxiv - Synthetic Biology 2019Quote: ... coli cultures using the PureLink Quick Plasmid Miniprep Kit (ThermoFisher). Input PCR products were purified using the GeneJet PCR purification kit (ThermoFisher) ...
-
bioRxiv - Biochemistry 2019Quote: ... mESCs were transfected with plasmid vectors using Lipofectamine 2000 (Invitrogen) and then seeded at low density on dishes coated with feeder cells ...
-
bioRxiv - Cancer Biology 2020Quote: ... for plasmids and Lipofectamine RNAiMAX Transfection Reagent (Thermo Fisher Scientific) for siRNA ...
-
bioRxiv - Neuroscience 2019Quote: ... Plasmids were amplified using DH5α competent cells (Thermo Fisher Scientific) and purified with Endofree plasmid maxi kit (Qiagen).
-
bioRxiv - Cancer Biology 2019Quote: ... DNA plasmids were transfected into Oneshot Stbl3 Competent Cells (Invitrogen) using the heat shock method ...
-
bioRxiv - Microbiology 2019Quote: ... and ligated into the plasmid vector pCRII-TOPO (Invitrogen, USA) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... The SUMO sequence was amplified from the petSUMO plasmid (Invitrogen) by PCR with Q5 polymerase (NEB ...
-
bioRxiv - Genomics 2021Quote: ... packaging plasmids using Lipofectamine LTX with Plus Reagent (Thermo Fisher). The standard culture medium was replaced after 12 h by culture medium with 30% FCS ...
-
bioRxiv - Systems Biology 2021Quote: ... plasmids were transfected using Lipofectamine LTX with PLUS™ (Invitrogen). Transfections were performed in 12-well plates with ~80% cell confluency at transfection ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The modified plasmid (pUG015) was digested with BglII (ThermoFisher, FD0083) and Gibson Assembly (NEB ...