Labshake search
Citations for Thermo Fisher :
1451 - 1500 of 10000+ citations for Mouse NXPE4 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: Plasmid transfections were performed using Lipofectamine 2000 (Thermo Fisher Scientific) and siRNA transfections were performed using Lipofectamine RNAiMAX (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... For further processing the GeneJET Plasmid Miniprep Kit (Thermo Fisher) was utilized as instructed ...
-
bioRxiv - Molecular Biology 2022Quote: ... coli with either PureLink™ HiPure Plasmid Midiprep Kit (Invitrogen) or PureLink™ HiPure Plasmid Miniprep Kit (Invitrogen) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Plasmids were transfected by lipofectamine LTX transfection reagent (ThermoFisher Scientific) in HEK293-T cells plated the day before in 6-well plates at approximately 70% confluence (800000 cells/well) ...
-
bioRxiv - Plant Biology 2022Quote: ... and ligation into pGEM-T plasmids (ThermoFisher Scientific, manufacturer’s conditions) of the PCR fragments were conducted for sequencing and probe preparation ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were transfected with reporter plasmids using Lipofectamine 3000 (ThermoFisher) according to the manufacturer protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... PureLink Pro Quick96 Plasmid Purification Kit (K211004A, Thermo Fisher Scientific) and Mini Plus Plasmid DNA Extraction System (GF2002 ...
-
bioRxiv - Neuroscience 2022Quote: ... Plasmids were amplified using DH5α competent cells (Thermo Fisher Scientific) and purified with the Endofree Plasmid Maxi Kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2022Quote: ... the constructed plasmid was transformed into DH10Bac (Thermo Fisher Scientific). After transformation ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were transfected with plasmid DNA using Lipofectamine 3000 (Invitrogen) according to manufacturer’s instruction (∼2 µg DNA per 1 × 106 cells).
-
bioRxiv - Plant Biology 2024Quote: All plasmids were generated using Gateway technology (Invitrogen, Life Technologies). pDONR vectors carrying the CDS of D14 and SMXL7 were recombined with pDEST plasmids to generate binary vectors by LR Clonase reactions ...
-
bioRxiv - Plant Biology 2024Quote: ... The homology donor plasmid was constructed via Gibson assembly (ThermoFisher GeneArt ...
-
bioRxiv - Cell Biology 2023Quote: ... plasmid was linearized using BbsI (Thermo Fisher Scientific, Cat. # ER1011) and the oligodeoxynucleotides encoding guide RNA (5′-ACCGCTGCTCTACCAAGATG ...
-
bioRxiv - Neuroscience 2024Quote: ... The expression plasmids were generated through the LR reaction (Invitrogen) by using entry vector and destination vector ...
-
bioRxiv - Plant Biology 2024Quote: ... coli cells using the GeneJet Plasmid MiniPrep kit (ThermoFisher Scientific).
-
bioRxiv - Plant Biology 2024Quote: All plasmids were generated using Gateway technology (Invitrogen, Life Technologies). pDONR vectors carrying the CDS of D14 and SMXL7 were recombined with pDEST plasmids to generate binary vectors by LR Clonase reactions ...
-
bioRxiv - Cell Biology 2024Quote: ... Plasmid transfections were carried out with Lipofectamine 3000 (ThermoFisher Scientific) according to manufacturer’s instructions for 5-6 hours ...
-
bioRxiv - Microbiology 2024Quote: ... and SiteB−/−HO1+PGL3 plasmids using Lipofectamine 2000 reagent (Invitrogen) for 6hrs ...
-
bioRxiv - Neuroscience 2024Quote: ... Plasmid transfection was conducted with Lipofectamine 3000 (L3000001, Thermo Fisher) according to the supplier’s protocol.
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... Standard curves using serial dilutions of plasmids (TOPO pCR2.1 (Invitrogen)) containing the target sequence (108-103 copies per 3 μl ...
-
bioRxiv - Cancer Biology 2024Quote: ... each plasmid library was electroporated into MegaX cells (Invitrogen #C640003), maintaining at least 2000X representation ...
-
bioRxiv - Cell Biology 2024Quote: ... Plasmid transfections were performed using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2024Quote: ... Plasmids were transfected by electroporation (Neon transfection system, Life Technologies) according to manufacturer’s protocols ...
-
bioRxiv - Developmental Biology 2024Quote: ... Plasmids were generated via Gateway® technology (Thermo Fisher Scientific). Open reading frames (ORFs ...
-
bioRxiv - Cell Biology 2024Quote: ... were co-transfected with plasmids pOG44 (Invitrogen, Thermo Fisher Scientific) and pcDNA5/FRT/TO/2K-NS4B-3xFLAG-APEX2 in 9:1 (w/w ...
-
bioRxiv - Cell Biology 2024Quote: ... were co-transfected with plasmids pOG44 (Invitrogen, Thermo Fisher Scientific) and pcDNA5/FRT/TO/2K-NS4B-3xFLAG-APEX2 in 9:1 (w/w ...
-
bioRxiv - Biophysics 2023Quote: ... 500 ng of plasmid DNA and 1.5 µl Lipofectamine2000 (Invitrogen) were separately incubated in 30 µl Neurobasal-A (Gibco/Thermo Fisher ...
-
bioRxiv - Cell Biology 2023Quote: ... The resulting plasmid was purified by Midiprep (Thermo Fisher Scientific), and the insert sequence was determined by Sanger sequencing ...
-
bioRxiv - Immunology 2023Quote: ... plasmids were used to transfect EXPI293F cells (Thermo Fisher Scientific) using 1 μg DNA/ml of cells with a ratio of light chain:heavy chain of 3:2 ...
-
bioRxiv - Plant Biology 2023Quote: ... Plasmids were recombined by addition of LR Clonase II (Invitrogen) with overnight incubation at 25°C ...
-
bioRxiv - Plant Biology 2023Quote: ... Plasmids were recombined by addition of LR Clonase II (Invitrogen) with overnight incubation at 25°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... purified using the PureLink™ HiPure Plasmid Miniprep Kit (Invitrogen), into the gonad of 1 day-old adult animals of the MosSCI acceptor strains ...
-
Rationally designed protein bandpass filters for controlling cellular signaling with chemical inputsbioRxiv - Synthetic Biology 2023Quote: ... plasmid DNA mixed with 50 μL opti-MEM (Thermo Fisher) and 600 ng of polyethyleneimine (24765-1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and cloned it in the pcDNA3.1/myc-His(-) plasmid (Invitrogen) in frame with a Myc-His tag to obtain the wild-type (WT ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were transfected with plasmid constructs using lipofectamine 3000 (Invitrogen) as per the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2023Quote: ... Plasmid DNAs were transfected using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2023Quote: ... and isolated using a GeneJET plasmid miniprep kit (Thermo Fisher). Sequencing was performed by ELIM Biopharmaceuticals ...
-
bioRxiv - Genomics 2023Quote: ... and 1µg of gRNA plasmid using Neon electroporation (Life Technologies). A week after transfection ...
-
bioRxiv - Microbiology 2023Quote: ... The plasmid pcDNA6.2/N-EmGFP-DEST obtained from Invitrogen (ThermoFisher). The CMV promoter ...
-
bioRxiv - Microbiology 2023Quote: ... were cloned into a pFRT expression plasmid (Thermo Fisher Scientific) in frame with an N-terminal Gaussia luciferase (Gluc ...
-
bioRxiv - Molecular Biology 2023Quote: ... and transforming the cloned plasmids into MAX EFFICIENCY DH10BAC (GIBCO) or EmBacY (Geneva Biotech ...
-
bioRxiv - Neuroscience 2023Quote: ... were transfected with the plasmids using Lipofectamine 3000 (Thermo Fisher) and cultured for 2 days at 37 °C and 5 % CO2 ...
-
bioRxiv - Neuroscience 2023Quote: ... Plasmids were transfected into HeLa cells using Lipofectamine 3000 (Invitrogen). Imaging was performed 24-48 h following transfection in a HEPES-buffered ACSF solution (20 mM HEPES pH 7.3 ...
-
bioRxiv - Biochemistry 2023Quote: ... coli colonies using the GeneJET Plasmid Miniprep Kit (ThermoFisher Scientific). The variable region of the library (position 19 to 83 ...
-
bioRxiv - Immunology 2022Quote: ... and cloned into the plasmid vector pJet (Thermo Fisher Scientific). The mRNA was synthesized by in vitro transcription using a DNA template with T7 promoter Φ6.5 (TAATACGACTCACTATAGGG) ...
-
bioRxiv - Microbiology 2023Quote: ... protein expression from plasmid (derivates of pBAD-His/B (Invitrogen) in all cases except expression of VirF from pCL5 [71] ...
-
bioRxiv - Biophysics 2023Quote: ... Plasmid DNAs were transfected using Lipofectamine 2000 (Thermo Fisher Scientific), according to the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2023Quote: ... plasmid was diluted in OptiMEM media (Reduced Serum Media, Gibco), mixed with PEI solution diluted in OptiMEM (3 μL PEI/μg DNA) ...
-
bioRxiv - Cell Biology 2023Quote: ... and/or the indicated plasmid with Lipofectamine 2000 (Thermo Fisher, 24 h after RNAi treatment or 24 h before imaging/harvesting) ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA and plasmid transfections were performed using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions ...