Labshake search
Citations for Thermo Fisher :
1251 - 1300 of 10000+ citations for Human Procollagen II C Terminal Propeptide PIICP CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... for 30 min at 25°C using a Click-iT Cell Reaction Buffer Kit (Thermo Fisher Scientific). After the removal of unreacted azide by MicroSpin G-25 columns (Cytiva) ...
-
bioRxiv - Developmental Biology 2024Quote: ... before performing an overnight in vitro transcription reaction at 16°C using the MegaScript IVT kit (Invitrogen). Remaining primers were removed by using EXOI/rSAP-IT (Applied Biosystems ...
-
bioRxiv - Genetics 2023Quote: ... The Hi-C library is quantified using the Qubit DNA high sensitivity kit (Thermo Scientific, cat. Q32851) on a Qubit 2 fluorometer (Thermo Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... c-DNA was synthesized as per protocol in the Superscript III Reverse Transcriptase kit (Invitrogen#18989-093). This was followed by Q-PCR using Sybr green mix (Promega) ...
-
bioRxiv - Bioengineering 2023Quote: ... the solution from b) and c) were collected and measured using an insulin ELISA kit (Thermo Fisher for mouse islets ...
-
bioRxiv - Genetics 2024Quote: ... 80°C for 20 minutes for inactivation and mRNA was synthesized using the T7 MEGAshortscript kit (ThermoFisher).
-
bioRxiv - Biochemistry 2024Quote: ... 4°C) and the protein concentration determined by a BCA assay (Pierce BCA Kit, Thermo Fisher Scientific). The human protein extracts were further processed to peptides in the same manner as described above for bacterial protein extracts.
-
bioRxiv - Neuroscience 2024Quote: ... EdU click-it assay was performed in organoid cryosections per manufacturer’s instructions (EdU kit Invitrogen, #C-10337) followed by immuno-staining for Ki67 ...
-
bioRxiv - Cell Biology 2021Quote: Primary human vein endothelial cells (HUVECs) were cultured in human endothelial SFM medium (Invitrogen) containing 20% foetal bovine serum ...
-
bioRxiv - Cell Biology 2020Quote: ... Human CD4+ T cells were activated by Dynabeads Human T-Activator CD3/CD28 (ThermoFisher) and cultured in AIMV medium (ThermoFisher ...
-
bioRxiv - Plant Biology 2023Quote: ... 2013) by means of LR recombination reactions using either LR II Clonase or LR II Clonase Plus (Invitrogen). The destination vector used to generate GFP-GUS promoter reporter lines was R4L1pGWB632 ...
-
bioRxiv - Bioengineering 2021Quote: ... + 2% human serum albumin (ThermoFisher) + 5 μM ROCKi (Tocris) ...
-
bioRxiv - Cell Biology 2020Quote: ... Human GR-specific siRNA (Invitrogen) was used at a concentration of 100 nM for 48 h to effectively knock down GR ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human primary melanocytes (Life Technologies) were grown in Medium 254 (Gibco ...
-
bioRxiv - Microbiology 2019Quote: ... including human 293FT cells (Invitrogen), rat2 cells (ATCC #CRL-1764) ...
-
bioRxiv - Physiology 2019Quote: ... human GDF15 (Hs00171132_m1 - ThermoFisher Scientific), human GAPDH (Hs02758991_g1 – ThermoFisher Scientific) ...
-
bioRxiv - Physiology 2019Quote: ... human GAPDH (Hs02758991_g1 – ThermoFisher Scientific), mouse HPRT (Forward – AGCCTAAGATGAGCGCAAGT ...
-
bioRxiv - Genetics 2019Quote: ... human COT-1 DNA (Invitrogen) and biotin-labeled mouse COT-1 or minor satellite DNA (a gift from Dr ...
-
bioRxiv - Genetics 2021Quote: ... human COT-1 DNA (ThermoFisher) to detect HSA21 and biotin-labeled I-EGFP-I-loxP-3’HPRT (ThermoFisher ...
-
bioRxiv - Bioengineering 2021Quote: ... recombinant human Vitronectin (Gibco A14700) was used at a final concentration of 25ug/ml ...
-
bioRxiv - Cancer Biology 2020Quote: Human recombinant IL-1β (ThermoFisher) was reconstituted in deionised water and administered at 10 ng/ml.
-
bioRxiv - Cell Biology 2021Quote: ... human FMR1 (Ambion, USA, 4392420) and human ATF4 (Ambion ...
-
bioRxiv - Molecular Biology 2022Quote: ... AlexaFluor633 anti-human (all ThermoFisher) used 1:2000 in PBS with 0.2% BSA ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human CD11b-APC (Thermo Fisher); Human CD34-PE (Miltenyi Biotec);and Human CD33-APC-Cy7 (Abcam).
-
bioRxiv - Microbiology 2020Quote: ... and anti-human SPIB (Invitrogen) antibodies by incubating for 45 minutes at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: Human epidermal keratinocytes (HEKs, Thermofisher), and patient keratinocytes ...
-
bioRxiv - Cancer Biology 2019Quote: ... Human Epidermal Melanocyte cells (Invitrogen) were cultured in Medium 254 (Invirogen ...
-
bioRxiv - Developmental Biology 2019Quote: ... and recombinant human FGF2 (Invitrogen) at 20 ng/ml ...
-
bioRxiv - Immunology 2021Quote: Human iPS cells (Thermo Fisher) were cultured on vitronectin-coated T225cm2 flasks using complete mTesSR Plus medium (StemCell Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... human COT1 DNA (Invitrogen, 15279011) and Vysis CEP hybridization buffer (Abbott Molecular ...
-
bioRxiv - Immunology 2020Quote: ... Human Expi293 cells (Thermo Scientific) were transfected with these constructs using FectoPro (PolyPlus Transfection ...
-
bioRxiv - Neuroscience 2021Quote: Human iPSCs (Thermo Fisher #A18945) were maintained in mTeSR1 medium (StemCell ...
-
bioRxiv - Neuroscience 2022Quote: ... and human ACTB (Thermofisher Hs01060665_g1). For other qPCRs ...
-
bioRxiv - Microbiology 2023Quote: ... human Gas6 (Invitrogen, cat# BMS2291), mouse Axl (Abcam ...
-
bioRxiv - Neuroscience 2022Quote: ... Human primary astrocytes (ThermoFisher #N7805200) were maintained as described in user manual ...
-
bioRxiv - Molecular Biology 2024Quote: ... human COT1 DNA (#15279011, Invitrogen) and 3 volumes of ethanol (#10000652 ...
-
bioRxiv - Immunology 2024Quote: ... or anti-human (Invitrogen #A11013) secondary antibodies at 20 μg/mL in PBS/2% BSA for 30 min ...
-
bioRxiv - Systems Biology 2023Quote: ... and human IgE-PE (ThermoFisher). Antibody details are shown in Table S4 ...
-
bioRxiv - Genomics 2023Quote: ... human p53 (Invitrogen, PA5-27822), MDM2 (Santa Cruz Biotechnology ...
-
bioRxiv - Cancer Biology 2023Quote: ... human IFN-gamma ELISA (Invitrogen) and granzyme B ELISA (R&D Systems ...
-
bioRxiv - Physiology 2023Quote: ... Human GR-specific siRNA (Invitrogen) was used at a concentration of 100 nM for 48 h to effectively knockdown GR ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-human CD235a (#17998742, Invitrogen), anti-human CD326 (EpCAM ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-human CD45 (#17945942, Invitrogen), anti-human CD235a (#17998742 ...
-
bioRxiv - Cell Biology 2023Quote: ... Human Cot-1 DNA (Invitrogen), 3M NaAc and 100% cold EtOH ...
-
bioRxiv - Cancer Biology 2024Quote: Recombinant human EGF (Gibco #PHG0311) was added to the medium of NCI-H23 or H23 KO cells at 80% confluency to reach a final concentration of 100 ng/mL ...
-
bioRxiv - Cancer Biology 2024Quote: ... Human Pool Set v3.0 (Thermofisher) and TaqMan™ MicroRNA Reverse Transcription Kit (Thermofisher) ...
-
bioRxiv - Genetics 2024Quote: ... human for rs2297550 from ThermoFisher.
-
bioRxiv - Molecular Biology 2020Quote: ... RNA expression analysis was performed with Affymetrix Human ClariomS® microarray using the WT Plus Reagent kit (ThermoFisher Scientific). As starting material ...
-
bioRxiv - Genomics 2019Quote: ... The mouse and human RNA samples were globin-depleted using the species-specific Ambion® GLOBINclear kit (Ambion, Thermofisher) and the RNA was quantified using a NanoDrop One spectrophotometer (Thermofisher).
-
bioRxiv - Genomics 2019Quote: ... The mouse and human RNA samples were globin-depleted using the species-specific Ambion® GLOBINclear kit (Ambion, Thermofisher) and the RNA was quantified using a NanoDrop One spectrophotometer (Thermofisher).