Labshake search
Citations for Thermo Fisher :
1251 - 1300 of 10000+ citations for 7H Diimidazo 1 5 a 1 5 4 de quinoxaline 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... 5 mg/ml Hoescht (Invitrogen)/PBS solution was carried out for 15min at RT ...
-
bioRxiv - Microbiology 2023Quote: ... 5% penicillin-streptomycin (Gibco; 15140122) and 1% L-glutamine (insert ref number) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 mM DTT (Thermo Scientific), 1.25 mM ATP (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... with %5 horse serum (Invitrogen) and PS.
-
bioRxiv - Bioengineering 2023Quote: ... and 5% FBS (ThermoFisher Scientific) for 2-3 hours at 37°C with 5% CO2 under gentle agitation38.
-
bioRxiv - Biochemistry 2023Quote: ... 5% penicillin/streptavidin (Life Technologies) was utilized to culture U2OS cells in conditions with 20% oxygen ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5% penicillin-streptomycin (Gibco, 15070063) and 5% GlutaMAX (Gibco ...
-
bioRxiv - Biophysics 2023Quote: 5 mM amiloride (Invitrogen, 17197349) was used to inhibit the formation of macropinosomes ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mM of MgCl2 (Ambion), and 10 mM of Tris buffer at a pH of 8.0 (Ambion ...
-
bioRxiv - Neuroscience 2023Quote: ... and 5 mM EDTA (Gibco) and 5.5 × 104 cells in 100 μl macrophage media were seeded onto each transwell (PET with 5 μm pores ...
-
bioRxiv - Cell Biology 2024Quote: ... supplemented with 5% FBS (Gibco), 100 U/ml penicillin ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 5% PFHM-II (Gibco) in APEL 2 base medium (Stemcell Technologies) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 5% GlutaMAX (Gibco, 35050061) was added ...
-
bioRxiv - Synthetic Biology 2024Quote: ... APC-CD4 (RM4-5; Invitrogen), APC-CD8 (53-6.7 ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 mL penicillin-streptomycin (Gibco). Cells were maintained at 37°C in a 5% CO2 incubator ...
-
bioRxiv - Molecular Biology 2024Quote: ... with 5% Horse serμ (Invitrogen), 1% Penicillin/Streptomycin ...
-
bioRxiv - Cell Biology 2024Quote: ... 5% penicillin and streptomycin (Gibco), 2 mM GlutaMAX (Gibco) ...
-
bioRxiv - Biophysics 2023Quote: ... + 5 mM TRIS (Invitrogen, AM9855G) + 50 mM MgCl2 (AppliChem ...
-
bioRxiv - Neuroscience 2024Quote: ... 5% Normal Goat Serum (Invitrogen) in PBS to permeabilize and block nonspecific staining ...
-
bioRxiv - Neuroscience 2024Quote: ... 5% FBS (vol/vol, Invitrogen), 4 mM L–glutamine (Invitrogen) ...
-
bioRxiv - Microbiology 2023Quote: ... 5 % Goat Serum ([GS], Gibco), and 0.1 % Triton X-100 in PBS for 2 h at room temperature ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 mM DRAQ5 (ThermoFisher #62251) was added to label nuclei.
-
bioRxiv - Cell Biology 2024Quote: ... paclitaxel (taxol, 5 nM; Invitrogen) and STLC (300 nM ...
-
bioRxiv - Cell Biology 2024Quote: ... supplemented with 5 % FBS (Gibco), 1% penicillin-streptomycin (Life Technologies ...
-
bioRxiv - Biochemistry 2023Quote: ... supplemented with 5% FBS (Gibco). In the experiments set to analyze sAPP in the conditioned medium ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 μg creatine kinase (Invitrogen) and 20U RNase inhibitor (NEB) ...
-
bioRxiv - Biochemistry 2024Quote: ... 5% glycerol (Thermo Fisher Scientific), 8 mM MgCl2 (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5% horse serum (Invitrogen, 16050130) and 0.2% Triton-X100 (Bio-rad ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mM KCl (Fisher Scientific), and 20 mM HEPES (Sigma-Aldrich) ...
-
bioRxiv - Systems Biology 2023Quote: ... After two freeze-thaw cycles in liquid nitrogen and defrost at 60°C 5 mg ml-1 lysozyme (Carl Roth) and 0.5 μl RNase A (Thermo Scientific™, 0.1 μg ml-1 final) was added and incubated for 1 h at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 mM of 4-(2-hydroxyethyl)-1-piperazine-1-ethanesulfonic acid (HEPES) (Gibco) and 1 ng/mL of human bFGF (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2022Quote: ... 1:2000) and 4′,6-diamidino-2-phenylindole (DAPI, 1:1,000, Life Technologies). Following several washes ...
-
bioRxiv - Neuroscience 2022Quote: ... IL-6 (1:4-1:2 dilution, #KMC0061; ThermoFisher Scientific, Waltham, MA, USA), and NfL (1:4 dilution ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) buffer (1 M) (Invitrogen, cat.#15630080), CellMask membrane dye (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... and probe E_Sarbeco_P1 (5′-FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ-3′) using the TaqPath 1-Step Multiplex Master Mix kit (Applied Biosystems) on a QuantStudio 5 real-time PCR system (Appiled Biosystems) ...
-
bioRxiv - Immunology 2021Quote: ... macrophages were preincubated for 5 min at 37 °C with 2.5 µM of Yo-Pro-1 iodide (Life Technologies) after galvanic current application or 1% triton X100 (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2021Quote: ... The fixed cells were washed with PBS and blocked with 5% goat serum for 1 hr (Thermo Fisher, 31872). Mouse anti-T7 primary antibody (Millipore Sigma ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... to the tube was added a solution of 0.269 mg of P58 mixed 5:1 by volume with salmon sperm DNA (Invitrogen), followed by 3 mL of 39.52% polyethylene glycol ...
-
bioRxiv - Bioengineering 2022Quote: ... Membranes were probed overnight at 4 °C with primary antibodies diluted to 1/2000 in 5% BSA and 0.1% sodium azide in PBS using specific total MET (#37-0100 Invitrogen), total ERK2 (#SC-154 Tebu-bio) ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were counterstained by 5 min incubation in 300 µM DAPI intermediate solution (1:1,000, Molecular Probes, Cat# B34650). Section were then washed with PBS three times ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3.125 μM Oligo-dT30VN (IDT, 5’AGCAGTGGTATCAACGCAGAGTACT30VN-3’) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher, 4456740)) into 384-well hard-shell PCR plates (Biorad HSP3901 ...
-
bioRxiv - Genetics 2020Quote: ... 1μl (equivalent to a 5:1 insert:vector ratio) was ligated into a blunt-ended TOPO vector (Zero Blunt TOPO PCR Cloning Kit, ThermoFisher) and transformed into E.coli ...
-
bioRxiv - Neuroscience 2019Quote: ... Thiol reactive fluorescent probe IAEDANs (1,5-IAEDANS, 5-((((2-iodoacetyl)amino)ethyl)amino)naphthalene-1-sulfonic Acid) was purchased from ThermoFisher Scientific ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... followed by permeabilization in 5% Triton-X for overnight and incubation in phalloidin Alexa-546 conjugate (Invitrogen, 1:500). All staining experiments were repeated three times with larvae from independent clutches.
-
bioRxiv - Biochemistry 2020Quote: ... 0.5% w/v sodium dodecyl sulfate) to which 400 μl of warm 5:1 Acid Phenol:Chloroform (Ambion, cat. # AM9722) were added and the resulting phase-separated mixture was agitated by vortexing at maximum speed for 15 sec ...
-
bioRxiv - Biochemistry 2020Quote: COS-1 and HEK293T cells were cultured at 37 °C and 5% CO2 in Dulbecco’s Modified Eagle Medium (DMEM, Gibco) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Neuroscience 2021Quote: ... and subsequently for 1 h in chicken polyclonal antibody against NF200 (RRID: AB_2313552, Aves) diluted 1:1000 in 5% normal goat serum (Cat #PCN5000, ThermoFisher), 0.5% TritonTM X-100 (Cat #9002-93-1 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Three tadpoles per stage (1, 2, 5, 7, and 8 weeks after hatching) were fixed in an RNAlater (Ambion) solution ...
-
bioRxiv - Biochemistry 2021Quote: ... The protein was diluted to 50 µM and labelled with a 5:1 molar excess of fluorophore:protein with either AlexaFluor 488 C5- Maleimide (Invitrogen) (AF488) ...
-
bioRxiv - Systems Biology 2021Quote: ... A 1:5 dilution of this protein solution was quantified using a Pierce BCA protein assay kit (Thermo scientific). For analysis of the relative composition of amino acids ...