Labshake search
Citations for Thermo Fisher :
1201 - 1250 of 10000+ citations for Recombinant Human GC Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... protein concentrations were determined by Bradford Protein Assay protein using Coomassie protein assay reagent (Thermo Fisher Scientific-Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: Primary human vein endothelial cells (HUVECs) were cultured in human endothelial SFM medium (Invitrogen) containing 20% foetal bovine serum ...
-
bioRxiv - Cell Biology 2020Quote: ... Human CD4+ T cells were activated by Dynabeads Human T-Activator CD3/CD28 (ThermoFisher) and cultured in AIMV medium (ThermoFisher ...
-
bioRxiv - Plant Biology 2020Quote: ... 1 µl of the hexane supernatant was then injected in a Trace GC Ultra gas chromatograph coupled to an ISQ mass spectrometer (Thermo Scientific). GC-MS analyses were performed as described in Brückner et al ...
-
bioRxiv - Genetics 2020Quote: ... PCR amplification of genomic DNA was performed using Phusion™ Green Hot Start II High Fidelity DNA Polymerase with GC Buffer in presence of 10% of DMSO (ThermoFisher). Big dye sequencing chemistry was used to sequence the PCR products in both directions using the ABI 3500xL Genetic analyser (Applied Biosystems ...
-
bioRxiv - Microbiology 2020Quote: ... A 1 μL aliquot of the derivative of the supernatant was added to a tube and analyzed using GC-MS (Trace DSQ II, Thermo Scientific). For data processing ...
-
bioRxiv - Microbiology 2019Quote: Gas chromatography coupled to isotope-ratio mass spectrometry (GC-IRMS) was performed on a TRACE 1310 Gas Chromatograph (Thermo Fisher Scientific) interfaced with a Scientific GC IsoLink II Conversion Unit connected to an IRMS DELTA V Advantage Isotope-ratio mass spectrometer (Thermo Fisher Scientific) ...
-
bioRxiv - Systems Biology 2019Quote: GC-FID (Supplementary Figure S1) analysis was accomplished on the TRACE™ 1310 gas chromatograph (Thermo Fisher Scientific™, Austin, TX). The detector temperature was set at 305 °C where the ignition threshold was 0.5 Pa ...
-
bioRxiv - Biochemistry 2020Quote: ... targeting the TLR3 gene (5’-CCUGAUGAUCUUCCCUCUAACAUAA-3’) and Stealth RNAi siRNA negative control med GC Duplex #2 were obtained from Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... Sterol profiles for each sample were determined by analyzing the integrated peak areas from GC-MS data files using Xcalibur software (Thermo Scientific). All sterol analysis was performed in biological triplicate ...
-
bioRxiv - Microbiology 2021Quote: ... Gas chromatography-mass spectroscopy (GC-MS) (with a Thermo 1300 gas chromatography system coupled to a Thermo ISQ mass spectrometer (Thermo Scientific) was used to analyze and identify TMS-derivatized sterols through comparison of the retention times and fragmentation spectra for known standards ...
-
bioRxiv - Microbiology 2021Quote: ... PCR fragments were amplified using appropriate primer pairs (Tables S2 and S3) and Phusion High-Fidelity PCR Master Mix with GC Buffer (Thermo Scientific). Linear fragments were purified on agarose gels ...
-
bioRxiv - Cell Biology 2021Quote: ... For RNA interference, 20 nM Stealth siRNAs (Steath RNAi Negative Control Med GC Duplex #2, 12935112; LONP, HSS113887) (Thermo Fisher Scientific) or 5 nM Silencer select siRNAs (Silencer Select Negative Control #1 siRNA ...
-
bioRxiv - Microbiology 2020Quote: ... Sterol profiles for each sample were determined by analyzing the integrated peak areas from GC-MS data files using Xcalibur software (Thermo Scientific). All sterol analysis was performed in biological triplicate.
-
bioRxiv - Biochemistry 2020Quote: ... The gas chromatography with the mode of Trace-1310 GC coupled to Triple quad mass spectrometer (MS) of the model TSQ8000 from Thermo Scientific is used to perform the analysis ...
-
bioRxiv - Biochemistry 2020Quote: ... or mouse monoclonal anti-N-Cadherin clone GC-4 followed by AlexaFluor 647-conjugated goat anti-mouse antibody (1:200 dilution, ThermoFisher Scientific). Staining was performed for 30 min at 4°C ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... These two constructs were co-transfected in GC-1 mouse testes cells at 80% confluency with Lipofectamine 3000 (Invitrogen Cat# L3000001) using 1.5μL of Lipofectamine and 250 ng of each vector in a well of a 24-well plate ...
-
bioRxiv - Systems Biology 2022Quote: ... The preparation of the plasma and urine samples for CCM GC-MS analysis consisted of adding 100% Methanol (LC-MS grade; Fisher Scientific).
-
bioRxiv - Microbiology 2022Quote: ... Extracellular associated bacteria identified by reaction with rabbit anti-Gc antibody (Meridian B65111R) that was conjugated in-house with 1 μg/mL Dylight 650 (Thermo Scientific) according to manufacturer’s recommendations ...
-
bioRxiv - Neuroscience 2022Quote: ... 5-10 cortical hemispheres containing axonal GCs were micro-dissected rapidly and homogenized in 0.32M sucrose supplemented with 4mM HEPES (Thermo Fisher, 15630106), Halt protease and phosphatase inhibitor cocktail (Thermo Fisher ...
-
bioRxiv - Biochemistry 2024Quote: ... and then in a GC B cell cocktail including: rat anti-mouse CD19 clone 1D3 PerCP-Cy5.5 conjugate (Fisher Scientific, BDB551001), hamster anti-mouse CD95 clone JO2 PE conjugate (Fisher Scientific ...
-
bioRxiv - Physiology 2023Quote: The dried polar extracts were prepared for GC-MS analysis through solubilization in 40 µL of 2% methoxyamine hydrochloric acid in pyridine (Fisher Scientific) at 60°C for 60 min and derivatization with 60 µL of N-tertbutyldimethylsilyl-N-methyltrifluoroacetamide (MTBSTFA ...
-
bioRxiv - Plant Biology 2023Quote: ... Mono- and sesquiterpenes were detected using a Trace GC Ultra gas chromatograph coupled with an ATAS Optic 3 injector and an ISQ mass spectrometer (Thermo Scientific) with electron impact ionization ...
-
bioRxiv - Plant Biology 2023Quote: ... Mono- and sesquiterpenes were detected using a Trace GC Ultra gas chromatograph coupled with an ATAS Optic 3 injector and an ISQ mass spectrometer (Thermo Scientific) with electron impact ionization ...
-
bioRxiv - Plant Biology 2024Quote: ... The identification and quantification of cell wall neutral sugars were performed by gas-chromatography (Trace GC Ultra, Thermo Fisher Scientific Inc.) after sulphuric acid degradation with or without a pre-hydrolysis step using 13 M sulphuric acid to determine the amount of glucose residues from acidic-resistant cellulose ...
-
bioRxiv - Microbiology 2024Quote: ... TMS-derivatized sterols were analyzed using gas chromatography–mass spectrometry (GS/MS) (Thermo 1300 GC coupled to a Thermo ISQ mass spectrometer, Thermo Scientific) and identified with reference to relative retention times ...
-
bioRxiv - Bioengineering 2024Quote: cDNA libraries were quantified via qPCR with TB Green Premix Ex Taq GC (Perfect Real Time) samples containing 1 × Power SYBR Green Master Mix (Applied Biosystems), 0.2 μM primers (forward ...
-
bioRxiv - Cell Biology 2024Quote: For gene silencing, cells were transfected with the Stealth™ RNAi (12935300, Med GC) as a negative control and siRNA (Invitrogen) to silence TMX2 or TOM70 expressions (siTMX2-1 ...
-
bioRxiv - Bioengineering 2021Quote: ... + 2% human serum albumin (ThermoFisher) + 5 μM ROCKi (Tocris) ...
-
bioRxiv - Cell Biology 2020Quote: ... Human GR-specific siRNA (Invitrogen) was used at a concentration of 100 nM for 48 h to effectively knock down GR ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human primary melanocytes (Life Technologies) were grown in Medium 254 (Gibco ...
-
bioRxiv - Microbiology 2019Quote: ... including human 293FT cells (Invitrogen), rat2 cells (ATCC #CRL-1764) ...
-
bioRxiv - Physiology 2019Quote: ... human GDF15 (Hs00171132_m1 - ThermoFisher Scientific), human GAPDH (Hs02758991_g1 – ThermoFisher Scientific) ...
-
bioRxiv - Physiology 2019Quote: ... human GAPDH (Hs02758991_g1 – ThermoFisher Scientific), mouse HPRT (Forward – AGCCTAAGATGAGCGCAAGT ...
-
bioRxiv - Genetics 2019Quote: ... human COT-1 DNA (Invitrogen) and biotin-labeled mouse COT-1 or minor satellite DNA (a gift from Dr ...
-
bioRxiv - Genetics 2021Quote: ... human COT-1 DNA (ThermoFisher) to detect HSA21 and biotin-labeled I-EGFP-I-loxP-3’HPRT (ThermoFisher ...
-
bioRxiv - Cell Biology 2021Quote: ... human FMR1 (Ambion, USA, 4392420) and human ATF4 (Ambion ...
-
bioRxiv - Molecular Biology 2022Quote: ... AlexaFluor633 anti-human (all ThermoFisher) used 1:2000 in PBS with 0.2% BSA ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human CD11b-APC (Thermo Fisher); Human CD34-PE (Miltenyi Biotec);and Human CD33-APC-Cy7 (Abcam).
-
bioRxiv - Microbiology 2020Quote: ... and anti-human SPIB (Invitrogen) antibodies by incubating for 45 minutes at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: Human epidermal keratinocytes (HEKs, Thermofisher), and patient keratinocytes ...
-
bioRxiv - Cancer Biology 2019Quote: ... Human Epidermal Melanocyte cells (Invitrogen) were cultured in Medium 254 (Invirogen ...
-
bioRxiv - Immunology 2021Quote: Human iPS cells (Thermo Fisher) were cultured on vitronectin-coated T225cm2 flasks using complete mTesSR Plus medium (StemCell Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... human COT1 DNA (Invitrogen, 15279011) and Vysis CEP hybridization buffer (Abbott Molecular ...
-
bioRxiv - Immunology 2020Quote: ... Human Expi293 cells (Thermo Scientific) were transfected with these constructs using FectoPro (PolyPlus Transfection ...
-
bioRxiv - Neuroscience 2021Quote: Human iPSCs (Thermo Fisher #A18945) were maintained in mTeSR1 medium (StemCell ...
-
bioRxiv - Immunology 2022Quote: ... APRIL Human ELISA Kit (ThermoFisher) and Human CD83 DuoSet ELISA Kit (R&D systems) ...
-
bioRxiv - Neuroscience 2022Quote: ... and human ACTB (Thermofisher Hs01060665_g1). For other qPCRs ...
-
bioRxiv - Microbiology 2023Quote: ... human Gas6 (Invitrogen, cat# BMS2291), mouse Axl (Abcam ...
-
bioRxiv - Neuroscience 2022Quote: ... Human primary astrocytes (ThermoFisher #N7805200) were maintained as described in user manual ...