Labshake search
Citations for Thermo Fisher :
1101 - 1150 of 10000+ citations for Recombinant Human GC Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... TotAZsk6 embryos were injected with a mixture of recombinant Cas9 (Invitrogen) and a gRNA targeting TotX coding sequence (GTTCAAGTTATGAGGAACACAGG) ...
-
bioRxiv - Immunology 2023Quote: Recombinant mAbs were transiently produced in FreeStyle 293F cells (ThermoFisher Scientific) following the protocol detailed by Vink et al (Vink ...
-
bioRxiv - Neuroscience 2023Quote: ... 200 units/ml RNaseOUT Recombinant Ribonuclease Inhibitor (#10777019; Thermo Fisher Scientific); 0.5 mm Spermidine (#S2626 ...
-
bioRxiv - Genetics 2023Quote: ... 50 ng/ml recombinant mouse epidermal growth factor (EGF; Gibco, PMG8041), 100 ng/ml recombinant murine Noggin (PeproTech ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1% penicillin/streptomycin and 50ng/ml recombinant mouse EGF (Life Technologies) was used for culturing ApcKO colon organoids ...
-
bioRxiv - Immunology 2023Quote: ... wiso embryos were injected with a mixture of recombinant Cas9 (Invitrogen) and a gRNA targeting the TotM coding sequence (ACTTATCGTAGAAAGTGACCAGG ...
-
bioRxiv - Cell Biology 2023Quote: ... recombinant bacmid DNA was generated in DH10Bac cells (Thermo Fisher 10361012), and isolated bacmid DNA was transfected into Sf9 cells (a gift from Yifan Cheng ...
-
bioRxiv - Cell Biology 2023Quote: ... Recombinant polyclonal anti-ALDOA antibody cocktail (711764) was purchased from Invitrogen. Goat polyclonal anti-PDGFRβ (sc-1627) ...
-
bioRxiv - Cell Biology 2024Quote: ... RNaseOUT Recombinant Ribonuclease Inhibitor (40 U/1 µL, Thermo Fisher Scientific), Universal RNA Spike II (0.005 ng/µL ...
-
bioRxiv - Biophysics 2024Quote: Recombinant baculoviruses were produced using the Bac-to-Bac system (Invitrogen) and infected Spodoptera frugiperda (Sf9 ...
-
bioRxiv - Microbiology 2024Quote: ... Recombinant plasmids were transfected into HEK293T cells using Lipofectamine 2000 (Invitrogen) together with lentiviral packaging vectors pMD2.G and psPAX2 (gifts from Didier Trono ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 0.5 uL Taq DNA Polymerase Recombinant (5u/ uL) (Invitrogen, Catalog #10342020), and 0.5 uL dsH2O to a total of 22.5 uL ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human transferrin-568 (ThermoFisher) was added at 10μg mL−1 concentration in serum free media and incubated at 37°C to allow for internalization ...
-
bioRxiv - Immunology 2021Quote: ... then anti-human (Invitrogen) horseradish peroxidase-conjugated antibodies were diluted 1:5,000 and 50 μL added to each well and incubated at 37°C for 1 h ...
-
bioRxiv - Cancer Biology 2022Quote: Probes Hs00171064_m1 (human, ThermoFisher), Mm00440280_g1 (mouse ...
-
bioRxiv - Bioengineering 2022Quote: ... Primary human hepatocytes (Gibco) were seeded in the top channel at a density of 3.5 x 106 cells/mL using complete hepatocyte seeding media ...
-
bioRxiv - Immunology 2020Quote: ... or anti-human (Invitrogen) horseradish peroxidase-conjugated antibodies were diluted 1:5,000 and 25 μL added to each well and incubated at 37°C for 1 h ...
-
bioRxiv - Microbiology 2021Quote: ... or human IgG (Invitrogen) as control ...
-
bioRxiv - Bioengineering 2022Quote: ... and human fibronectin (Gibco) at 50 μg/mL in PBS ...
-
bioRxiv - Cell Biology 2022Quote: ... human (ThermoFisher Scientific, 902927). Analysis was performed with Transcriptome Analysis Console 4.0 software (Applied Biosystems ...
-
bioRxiv - Immunology 2022Quote: ... then anti-human (Invitrogen) horseradish peroxidase-conjugated antibodies were diluted 1:5,000 and 50 μL added to each well and incubated at 37°C for 1 h ...
-
bioRxiv - Immunology 2024Quote: ... Anti-Human-HRP (Invitrogen) was diluted 1:5000 in 1% BSA/PBS ...
-
bioRxiv - Molecular Biology 2024Quote: ... CD36 (Human tissue Thermofisher: PA1-16813 1:500 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1% human IgG (Invitrogen) in PBS] followed by incubation with primary antibodies ...
-
bioRxiv - Cell Biology 2023Quote: ... human plasma (ThermoFisher, #33016015); Laminin 111 ...
-
bioRxiv - Immunology 2023Quote: ... A Human ProcartaPlexTM (Invitrogen) immunoassay was additionally used to detect 45 human cytokines ...
-
bioRxiv - Cancer Biology 2024Quote: ... human CD3-PE (Invitrogen), and mouse CD45-erpCP Cy5.5 (BD Biosciences ...
-
bioRxiv - Cancer Biology 2024Quote: ... Samples were tested on preconfigured 96-well qPCR plates (Human glycosylation – 4413255, Human Inflammation - 4418851 or Human tumor metastasis – 4418743, Thermofisher Scientific), with 100 ng added to each well ...
-
bioRxiv - Cancer Biology 2024Quote: Isolated human PBMCs (ATCC PCS-800-011) were activated with human monoclonal antibodies against human CD3 (OKT3, Life Technologies, 16-0037) coated onto a flask and 2 ug/ml CD28 (CD28.2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... HeLa cells in 35-mm dishes were transfected with 100 pmol of each siRNA in the Stealth siRNA library targeting 154 human nuclear proteins (Invitrogen–Thermo Fisher Scientific) using Lipofectamine RNAiMax (Invitrogen–Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: Cell culture supernatants were analyzed for secreted proteins using Immune Monitoring 65-Plex Human ProcartaPlex™ Panel for MAGPIX (Thermofisher Scientific, Carlsbad, CA) as per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: Cell culture supernatants were analyzed for secreted proteins using Immune Monitoring 65-Plex Human ProcartaPlex™ Panel for MAGPIX (Thermofisher Scientific, Carlsbad, CA) as per manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: Epidermal growth factor receptor (EGFR) protein expression levels on the surface of Gli36-derived EVs were quantified using an EGFR Human ELISA kit (ThermoFisher Scientific, Waltham, MA). EVs were spiked in healthy donor serum at different concentrations ranging from 0 to 1.0E11 particles/mL while maintaining the serum-derived EV concentration at 1.0E9 particles/mL ...
-
bioRxiv - Neuroscience 2024Quote: ... were determined by matching the UniProt human protein database (release 2023_01) with the acquired fragmentation pattern using Sequest (Thermo Fisher Scientific, Waltham, MA) (Eng et al. ...
-
bioRxiv - Physiology 2019Quote: The metabolites were detected using the Trace 1300/ITQ 900 GC-MS system (Thermo Fisher Scientific, USA, Serial No.13005). GC-MS analysis were conducted as previously reported [16] with slight modifications ...
-
bioRxiv - Microbiology 2021Quote: ... Eluting peaks were transferred at an auxiliary transfer temperature of 250 °C to a I0-GC mass spectrometer (Thermo Scientific), with a filament delay of 5 min ...
-
bioRxiv - Cell Biology 2022Quote: ... Hela cells were plated on cover slips and then transfected with a total of 600 pg of either a scrambled control siRNA oligo medium GC content (Invitrogen) or a mix of three siRNA oligos HSS121071 (Epsin-1) ...
-
bioRxiv - Cell Biology 2020Quote: ... For the GC-MS analysis 1 µL of each sample was injected using a PAL autosamplee system (Thermo Fisher Scientifc) using a Split/Splitless (SSL ...
-
bioRxiv - Genetics 2021Quote: ... The genomic region surrounding the CRISPR/Cas9 target site (741 bp) was PCR amplified using AccuPrime GC-Rich DNA Polymerase (Invitrogen) (Table S1) ...
-
bioRxiv - Neuroscience 2024Quote: PCR amplification of the DNA has been performed with Phusion high fidelity master mix with GC buffer (ref F532L, ThermoFisher). The primers for PCR amplification have been selected with PerlPrimer.37 The different primers pairs are presented in Table 1.
-
bioRxiv - Microbiology 2023Quote: Analytical gas chromatography of FAME was carried out in a GC-MS Trace 1300 / ISQ 7000 system (Thermo Fisher Scientific) equipped with a BPX70 capillary column (25 m ...
-
bioRxiv - Biochemistry 2024Quote: All siRNAs (siControl: Stealth RNAiTM siRNA Negative Control, Med GC, siMat2a #911: MSS232488) were obtained from Invitrogen (Carlsbad, CA, USA). The target sequence of the siMat2a (911 ...
-
bioRxiv - Biochemistry 2023Quote: ... inside of a GC vial with a 9 mm PTFE/red rubber septum (CAS#C4000-30, Thermo scientific, Rockwood, TN). Samples were placed in an AI/AS 1300 autosampler prior to auto injection ...
-
bioRxiv - Molecular Biology 2023Quote: ... All eluting peaks were transferred through an auxiliary transfer line into a Q Exactive-GC-MS (Thermo Scientific, Bremen, Germany). Raw data obtained from data acquired by GC/MS were converted using the open source ProteoWizard’s msConvert software prior to data preprocessing with MS-DIAL 4.6 software (Riken ...
-
bioRxiv - Bioengineering 2023Quote: ... The numerical values of total taxanes obtained from the GC-MS TRACE™ 1300 Gas Chromatograph (Thermo Fisher Scientific, UK) were used as a response in the designs ...
-
bioRxiv - Systems Biology 2023Quote: ... All eluting peaks were transferred through an auxiliary transfer line into a Q Exactive-GC-MS (Thermo Scientific, Bremen, Germany). The total run time was 25 min ...
-
bioRxiv - Immunology 2023Quote: ... 5% (v/v) DMSO if the sequence was GC-rich and UltraPure DNase/RNase-free distilled water (Invitrogen; cat # 10977015) to a final volume of 20 μL ...
-
bioRxiv - Biochemistry 2023Quote: Monolayers of HEK293T cells cultivated on coverslips were co-transfected with equimolar amounts of SIDT1/2-GN and SIDT1/2-GC plasmids using Lipofectamine 3000 (Invitrogen). After 24 hours of transfection ...
-
bioRxiv - Molecular Biology 2024Quote: ... CTG Hairpin-Biotin and GC Clamp-Biotin were bound to Streptavidin Magnetic Beads (Dynabeads® M-280 Streptavidin, Life Technologies) with a 50 nM final concentration of biotinylated antigen for the first round and 10 nM final concentration of biotinylated antigen for the second and third rounds.
-
bioRxiv - Microbiology 2020Quote: ... we used human monoclonal antibodies produced recombinantly in human Expi293F cells (Life Technologies) as described before (Fang et al ...