Labshake search
Citations for Thermo Fisher :
1201 - 1250 of 10000+ citations for N acetylglucosamine 1 phosphodiester alpha N acetylglucosaminidase NAGPA Antibody FITC since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2022Quote: ... 2) alpha-SMA-eFluor660 (1:150; ThermoFisher Scientific; 50-9760-82), TGF-beta-PE (1:100 ...
-
bioRxiv - Developmental Biology 2024Quote: ... Alpha-bungarotoxin (BTX) conjugated with Alexa Fluor 647 (1:500, Invitrogen) was used in order to visualize nicotinic acetylcholine receptor densities ...
-
bioRxiv - Cell Biology 2022Quote: ... alpha-tubulin (MS-581, Thermo Fisher; 1:10,000 for western blotting) Lamin B1 (ab16048 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Alpha Amylase (rabbit polyclonal, 1:200; PA5-51078, Thermo Fisher Scientific), Insulin (rabbit polyclonal ...
-
bioRxiv - Cell Biology 2021Quote: ... CD45-FITC (1:1000, Invitrogen 11-0451-82), ITAG7(a7)-APC (1:1000 ...
-
bioRxiv - Cell Biology 2021Quote: ... FITC or Atto647N (1:200; Invitrogen and Sigma). Specimens were embedded in ProLong Gold Antifade mounting medium.
-
bioRxiv - Cell Biology 2022Quote: ... FITC-conjugated phalloidin (1:1,000, Thermo Fisher Scientific); AlexaFluor 488 anti-mouse ...
-
bioRxiv - Cancer Biology 2023Quote: ... CD38-FITC (1:50, clone HIT2; Life Technologies). For exclusion of dead cells ...
-
bioRxiv - Biophysics 2023Quote: ... or anti-PD-1 FITC (MIH4, Invitrogen, USA) to determine their levels of activation during expansion experiments (days 0-7) ...
-
bioRxiv - Developmental Biology 2023Quote: α6-FITC (1:200, Invitrogen, 11-0495-82),
-
bioRxiv - Cell Biology 2024Quote: ... FITC or Atto647N (1:100; Invitrogen and Sigma). Specimens were embedded in ProLong Gold Antifade Mountant (ThermoFisher Scientific).
-
bioRxiv - Immunology 2024Quote: ... or LAMP-1/CD107a monoclonal antibody specific for the lysosomal-associated membrane protein 1 (LAMP-1) of the parasitophorous vacuole (rat IgG2a FITC, Invitrogen, CA). Revelation was performed with 1.5 μg/ml streptavidin conjugated to Texas Red (Molecular Probes ...
-
bioRxiv - Cell Biology 2021Quote: ... a rat monoclonal antibody against yeast alpha-tubulin (clone YL1/2) from Thermo Fisher Scientific (Pittsburgh ...
-
bioRxiv - Biophysics 2024Quote: ... Microtubules were stained with mouse alpha and beta tubulin antibodies (WA31679510 and TG2597441, Invitrogen) at 1:1:200 dilution in PBS overnight at 4 °C and goat anti-mouse STAR Red (Abberior GmbH ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were incubated with an alpha tubulin monoclonal antibody conjugated to Alexa Fluor 488 (B-5-1-2, Invitrogen, Carlsbad, CA) at 2 μg/mL in 1% BSA in PBS for 1 hour ...
-
bioRxiv - Cancer Biology 2020Quote: ... The FITC-labeled anti-BrdU antibody was purchased from Thermo Fisher Scientific (11-5071-42 ...
-
bioRxiv - Cell Biology 2020Quote: ... and then with secondary antibodies conjugated with FITC or Alex (Invitrogen) according to the manufacturer’s directions ...
-
bioRxiv - Biochemistry 2022Quote: ... A mixture containing 20µL LUV and 8µg anti-FITC antibody (Thermofisher) was prepared ...
-
bioRxiv - Immunology 2021Quote: ... Polyclonal FITC rabbit anti-mouse antibody was purchased from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Developmental Biology 2024Quote: ... Live label antibodies were CD326 with FITC (11-5791-82, Invitrogen) and Lectin PNA From Arachis hypogaea with Alexa Fluor 647 (L32640 ...
-
bioRxiv - Developmental Biology 2021Quote: ... cells were incubated in FITC-conjugated mouse anti-CD150a (PDGFRA) antibody (1:1000 dilution) (ThermoFisher 11-1401-82). Flow cytometric cell sorting and analysis was performed on a SORP FACSAria III (BD) ...
-
bioRxiv - Biochemistry 2022Quote: ... and probed for 2 h with an FITC-conjugated goat anti-rat antibody (1:300, Thermo Fisher Scientific). VE-cadherin in the superficial vascular plexus and deep capillary plexus was visualized in the retinas by confocal microscopy as illustrated in Fig ...
-
bioRxiv - Biochemistry 2023Quote: ... The following antibody cocktail was used: mCD3 (FITC, clone 17A2, Invitrogen Cat No.11-0032-80, 1:100) and mCD19 (APC ...
-
bioRxiv - Cell Biology 2020Quote: ... adapter-ligated template was digested with 5 U of AmpErase Uracil N-Glycosylase (Life Technologies, N8080096). Libraries were then PCR amplified and indexed using Phusion Hot Start II High Fidelity Polymerase (Thermo Scientific ...
-
bioRxiv - Immunology 2021Quote: ... 4 mice pooled per n) were deeply anesthetized and perfused intracardially with ice-cold dPBS (Gibco). Forebrain tissue were aseptically dissected ...
-
bioRxiv - Developmental Biology 2021Quote: ... Flag-Tdrd3-N and Flag-Tdrd3-C were synthesized with an mMESSAGE mMACHINE SP6 kit (Ambion), and the resulting mRNAs (2 μg ...
-
bioRxiv - Genomics 2020Quote: ... and total RNA was extracted from five (n=5) COVID-19 positive patients using TRIzol (Invitrogen) reagent following manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... and Kcns3neo/neo mice (n=5 per genotype) and homogenized in TRIzol reagent (Invitrogen, Carlsbad, CA). Total RNA samples were prepared from the homogenates using RNeasy lipid tissue mini kit (Qiagen ...
-
bioRxiv - Neuroscience 2020Quote: ... N-terminally HA-tagged AMPAR constructs were expressed from the doxycycline inducible pcDNA4/TO vector (Invitrogen Cat ...
-
bioRxiv - Biophysics 2022Quote: DDM-solubilized claudin-4 was biotinylated using N-hydroxysuccinimide polyethylene glycol biotin (NHS-PEG4-biotin, ThermoFisher) by mixing 5.6 μM claudin-4 with 16.8 μM NHS-PEG4-biotin ...
-
bioRxiv - Neuroscience 2021Quote: ... Tissue or cells were lysed in N-PER™ Neuronal Protein Extraction Reagent (#87792, Thermo Fisher) supplemented with protease and phosphatase inhibitor cocktail (#78440 ...
-
bioRxiv - Microbiology 2021Quote: ... All toxins and chimeras were expressed and purified with cleavable N-terminal 6His-SUMO fusions (ThermoFisher), grown to an OD600 of 0.8 in LB media ...
-
bioRxiv - Neuroscience 2020Quote: ... Tissue or cells were lysed using N-PER™ Neuronal Protein Extraction Reagent (#87792, Thermo Fisher) supplemented with protease inhibitor cocktail (#5871S ...
-
bioRxiv - Microbiology 2021Quote: ... and 25 ng linear pPolI-SARS-CoV2-NLuc-N plasmid using 2μl of Lipofectamine 2000 (Invitrogen) to a DNA:lipofectamine ratio of 1:3 and 100μl Opti-MEM (Gibco) ...
-
bioRxiv - Cancer Biology 2020Quote: ... cell viability (n =3) was assayed at different times using the PrestoBlue cytotoxicity assay (Thermo Fisher), according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... The N-based assay used a standard curve synthesized as follows: T7 in vitro transcription (ThermoFisher) of a synthetically produced N sequence (IDT ...
-
bioRxiv - Physiology 2021Quote: ... homogenized individually (N = 30 per condition and per independent experiment) in 500 μl of TRIzol (Invitrogen) and stored at −80°C until RNA extraction.
-
bioRxiv - Cell Biology 2020Quote: ... the N-terminal His6-tag was removed by the addition of His6-rTEV protease (Life Technologies) and dialyzed in H Buffer for 36 h at 4°C ...
-
bioRxiv - Developmental Biology 2022Quote: Mouse zygotes (C57BL6/N strain) were injected with 200 ng/µL Cas9 protein (IDT and ThermoFisher), 100 ng/µL Fzd2-specific sgRNA (GCAAGACACTGCACTCGTGG) ...
-
bioRxiv - Neuroscience 2022Quote: ... compound and sectioned into six series of 40μm coronal sections (Microm HM N°560, Thermo Scientific) into 1xPBS containing 0.1% sodium azide ...
-
bioRxiv - Microbiology 2020Quote: ... Amersham Hybond-N+ nylon and Amercham Hybon-XL nitrocellulose membaranes were purchased from ThermoFisher (Illkirch, France).
-
bioRxiv - Microbiology 2020Quote: ... the sequence of the plasmid EGFP-N was confirmed by sequencing (Gene Art–Thermo Fisher Scientific).
-
bioRxiv - Cancer Biology 2020Quote: ... adapter-ligated template was digested with 5 U of AmpErase Uracil N-Glycosylase (Life Technologies, N8080096). Libraries were then PCR amplified and indexed using Phusion Hot Start II High Fidelity Polymerase (Thermo Scientific ...
-
bioRxiv - Developmental Biology 2021Quote: ... The hiPSCs were maintained on vitronectin (VTN-N; cat. num. A14700; Thermo Fisher Scientific, Waltham, MA)-coated plates in Essential 8 Flex medium (E8 ...
-
bioRxiv - Microbiology 2022Quote: ... The online desalting column (trap column) used was a C18 column (Thermo Scientific P/N 160454). At 4.6 min the flow from the nano pump was diverted to the trap column in a backward flush direction ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Total RNA was isolated from liver tissues (n=4-5 mice/group) using Trizol (ThermoFisher Scientific). Concentration was measured by nanodrop (ThermoFisher Scientific ...
-
bioRxiv - Developmental Biology 2020Quote: Proteins were extracted from iPSC using N-PER™ Neuronal Protein Extraction Reagent (Thermo Fisher Scientific) supplemented with protease (cOmplete™ Mini Protease Inhibitor Cocktail ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNase I digestion was stopped by adding 10U of Superase Inhibitor (Thermo Scientific, cat. n° AM2696) for 10 min on ice ...
-
bioRxiv - Molecular Biology 2020Quote: ... Validation of second strand synthesis was performed by Nuclease S1 digestion (Thermo Fisher, cat n°EN0321) according to manufacturer’s instructions.
-
bioRxiv - Immunology 2021Quote: ... the N and ORF1ab were detected using FAM and VIC labelled Taqman probe by Applied Biosystems™ 7500 (ThermoFisher Scientific) ...