Labshake search
Citations for Thermo Fisher :
1151 - 1200 of 10000+ citations for Fipronil Sulfone 3 Cyano Pyrazole 3 4 5 13C4 99%; 3 Cyano 5 15N2 98% 100 Ug Ml In Methanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... Beads were then washed with ice-cold lysis buffer 3 times for 5 minutes and proteins were recovered by boiling in denaturing loading buffer (Invitrogen).
-
bioRxiv - Microbiology 2020Quote: ... 100 ng of extracted vRNAs were reverse transcribed using a Uni-12 primer (5’-AGCRAAAGCAGG-3’) and Superscript III reverse transcriptase (Invitrogen). Quantification was performed by qPCR on a Rotor-Gene Q 2plex System (Qiagen ...
-
bioRxiv - Developmental Biology 2020Quote: ... Slides were then washed with PBS-T (3 × 5 min) and incubated with fluorophore-conjugated secondary antibodies (1:500 in blocking buffer, Invitrogen). Hoechst 33258 (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was synthesized using the env V1/V3 Primer ID primer (HXB2 positions 6585-7208): 5’-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNNNNNCAGTCCATTTTGCT CTACTAATGTTACAATGTGC-3’ and SuperScript III Reverse Transcriptase (Invitrogen). The final cDNA reaction contained the following ...
-
bioRxiv - Microbiology 2020Quote: ... one or two guanines were added to the 5’ end of the guide sequence within the primer to ensure the format “5’-GG(N18-20)-3’” in order to facilitate in vitro transcription with MEGAscript T7 in vitro transcription kit (Ambion). Transcribed sgRNAs were purified with MEGAclear kit (Invitrogen) ...
-
bioRxiv - Microbiology 2021Quote: ... and cDNAs were synthesized using SARS-CoV-2 nucleocapsid (N) reverse primer N660R (5’-AGCAAGAGCAGCATCACCGCCATTGCCAGC-3’) and M-MLV reverse transcriptase (Invitrogen). Then ...
-
bioRxiv - Genomics 2021Quote: RNA from individual E10.5 hearts (N=3 or 5 per genotype) was isolated using the RNAqueous-Micro Total RNA Isolation Kit following manufacturer recommended protocols (Invitrogen). cDNA synthesis was performed using random hexamers and SuperScript IV reverse transcriptase (Invitrogen) ...
-
bioRxiv - Genomics 2021Quote: ... 10 µg of antibody (3 µg for H3K27ac) was added to 5 µg of sonicated chromatin along with Dynabeads Protein A magnetic beads (Invitrogen) and incubated at 4 °C overnight ...
-
bioRxiv - Immunology 2021Quote: ... 4 million cells per sample were stimulated ex vivo for 3 hours at 5% CO2 at 37°C in Minimum Essential Media (Gibco) containing 10% fetal bovine serum (FBS ...
-
bioRxiv - Cancer Biology 2020Quote: ... HGrC1 cells (15 samples including 3 replicates for 5 conditions) were lysed using TRIzol reagent (catalog #15596026, Thermo Fisher Scientific) and RNA was extracted with Direct-zol RNA MiniPrep kit (#R2052 ...
-
bioRxiv - Immunology 2021Quote: ... 4 million isolated splenocytes or inguinal lymph node cells were stimulated ex vivo for 3 hours at 5% CO2 at 37°C in Minimum Essential Media (Gibco) containing 10% fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2021Quote: ... Qβ-VLPs were then re-packaged with B-type 1668 CpGs (5″-TCC ATG ACG TTC CTG ATG CT-3″) with phosphorothioate backbone purchased from (InvitroGen). The re-packaging was confirmed by 1% agarose gel stained with SYBR Safe dye for 30min at 90V ...
-
bioRxiv - Microbiology 2020Quote: ... 1 μL (10μM) reverse primer (ldh4_R, 5’-AATCACAGCAGCCCCTTG-3’) and 1 μL (1 U/μL) Platinum Taq DNA polymerase (Invitrogen, 10966-018) in a 50 μL total reaction volume ...
-
bioRxiv - Developmental Biology 2022Quote: ... 10 µg of antibody (3 µg for H3K27ac) was added to 5 µg of sonicated chromatin along with Dynabeads Protein A magnetic beads (Invitrogen) and incubated at 4 °C overnight ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were then washed 3 times for 5 minutes each with PBS and mounted using ProLong Diamond anti-fade mountant with DAPI (Invitrogen) and allowed to cure overnight ...
-
bioRxiv - Cell Biology 2022Quote: ... 5′-CCUGGAUAAUGAUGAAGGA-3′), OSBP (predesigned, cat. no. 4392420) and nontargeting control siRNA (predesigned, cat. no. 4390844) were purchased from Ambion. ON-TARGET plus Human PI4K2A siRNA (predesigned ...
-
bioRxiv - Cell Biology 2022Quote: ... All samples were boiled for 5 min prior to separation by SDS PAGE on precast 3-8% Tris-Acetate NuPAGE gels (Invitrogen). SDS-PAGE fractionated proteins were transferred to a nitrocellulose membrane using a semidry Trans-Blot Turbo Transfer System (Bio-rad) ...
-
bioRxiv - Physiology 2022Quote: ... R:3’-UUGAACGUCACUAUAUUAACUGUUGUA-5’) dicer-substrate siRNA (DsiRNA) (20 nM, Integrated DNA Technologies, Coralville, IA) using Lipofectamine 3000 transfection reagent (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... Peptides were separated using 50 cm Acclaim PepMap 100 analytical column (75 μm ID, 3 μm C18) in conjunction with a Pepmap trapping column (100μm × 2 cm, 5 μm C18) (Thermo Scientific) analysed with Orbitrap Fusion Tribrid mass spectrometer (Thermo-Fisher Scientific) ...
-
bioRxiv - Microbiology 2024Quote: ... Tenfold dilutions were used to infect confluent Vero E6 cells in a 96-well plate in MEM (5% FBS, 1% penicillin-streptomycin, 1% kanamycin, 3% amphotericin B (Gibco)) at 37°C and 5% CO2 ...
-
bioRxiv - Biophysics 2024Quote: ... Individual reactions were heated to 65 °C for 5 min and transferred to ice for 3 min to facilitate annealing in SuperScript III reaction buffer (Invitrogen). After annealing ...
-
bioRxiv - Cell Biology 2023Quote: Sac2 knockdown was performed with siRNA targeting mouse gene sequence Inpp5f: 5’-GGAAUGCGGUAUAAACGAATT-3’ and was from Ambion (Life Technologies). OSBP knockdown was performed using ON-TARGET plus SMART pool Mouse OSBP siRNA from Dharmacon ...
-
bioRxiv - Neuroscience 2024Quote: ... The following day the sections were washed 3 times for 5 min each in PBS-T and incubated with the corresponding secondary antibodies (all 1:1000, Invitrogen), for 2 h at room temperature ...
-
bioRxiv - Microbiology 2024Quote: ... 20% PE: 5% PS) were prepared as described in (49) with the addition of DiOC18(3) (3,3’-Dioctadecyloxacarbocyanine Perchlorate) (Invitrogen, D275) for fluorescence ...
-
bioRxiv - Neuroscience 2024Quote: ... Samples were rinsed 3 x 5 minutes with 1X PBS before mounting with Fluoromount G (Fisher Scientific; 50-259-73).
-
bioRxiv - Neuroscience 2023Quote: ... Sections were then washed 3× for 5 min each in PB and mounted with Prolong Gold (Thermo Fisher cat#P36930) and Deckglaser cover glass (Fisher Scientific cat#NC1776158) ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were grown in 24 -well plates to ∼60% confluency and transfected with small interfering RNA specific to TRPM2 (TRPM2-siRNA, 5′-GAAAGAAUGCGUGUAUUUUGUAA-3′, custom-made by Dharmacon) or scrambled control siRNA (Scr-siRNA: 4390846, Ambion) in Opti-MEMTM using 25 nM siRNA and 1 ul of Lipofectamine® RNAiMAX28 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1μl of oligo-dT30VN primer (10 μM 5’-aagcagtggttatcaacgcagagtact30vn-3’) and 1 μl of 10 mM dNTP mix (Thermo Fisher). Illumina libraries were prepared by using a modified smart-seq2 protocol [Picelli 2014] using SuperScript IV RT and tagmentation procedure as previously described [Henning 2018] ...
-
bioRxiv - Biochemistry 2024Quote: ... Samples were subsequently washed 3 x 5 mins with PBS and incubated in fluorescently conjugated secondary antibodies (goat anti-mouse Alexa Fluor 488, ThermoFisher #A11001 ...
-
bioRxiv - Bioengineering 2024Quote: ... PCR primers (F primer 5’ agatcagatctttgtcgatcctacca 3’ and R primer 5’tcatctcccggggttgtggc 3’) were used to amplify the entire first cistron and IRES using Accuprime Pfx (Invitrogen) for 30 cycles ...
-
bioRxiv - Cell Biology 2024Quote: ... On the day of electroporation organoids were dissociated into small clumps of 3-5 cells using mechanical pipetting and TrypLE incubation and resuspended in Opti-MEM Reduced Serum Medium (Gibco). 5 μg of the cloned REG1A sgRNA-plasmid ...
-
bioRxiv - Zoology 2023Quote: ... the sections were again washed with TBS (3 times; 5 min each) and mounted in Fluromount-G mounting media with DAPI (004959-52, Invitrogen). The dried slides were visualized using Leica DM4000B fluorescence microscope equipped with Leica DFC310 FX camera ...
-
bioRxiv - Neuroscience 2023Quote: ... washed in PBS (3 x 5 min) mounted on glass slides (SuperFrost Plus Microscope Slides, ThermoFisher Scientific, Waltham, MA, USA) and left to air-dry overnight ...
-
bioRxiv - Neuroscience 2023Quote: ... Coverslips were then washed 3 x for 5 min with 1x PBS before mounting onto glass slides using ProLong Diamond Antifade mountant (Invitrogen) and left to dry for 24 hr at 4°C before imaging ...
-
bioRxiv - Cell Biology 2023Quote: ... Slides were washed in 3 baths of PBS for 5 min each and mounted in Prolong Gold (Invitrogen Cat. #P36934) with a glass coverslip applied over the tissue sections ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were then washed for 3×5 minutes in PBT and mounted on a slide in a drop (∼40 µL) of SlowFade Diamond antifade (Invitrogen), covered in a 22×50 mm #1.5 coverslip sealed with nail polish ...
-
bioRxiv - Microbiology 2023Quote: ... /AgeI-Reverse (5’-AAGTTTAAGCACGTACCGGTACGC-3’) containing the desired mutation were used to amplify two PCR products using AccuPrime Taq (Invitrogen). The amplicons were digested with either XmaI or AgeI restriction enzymes (New England Biolabs) ...
-
bioRxiv - Cell Biology 2023Quote: ... RPE-1 cells or MiniBAR-GFP stable cell lines were transfected with 25 nM of siRNAs targeting either luciferase or human Mini-BAR (5’-CUGCAAAUUUUACGGAUCA-3’) using Lipo-fectamine RNAiMAX (Invitrogen), following the manufac-turer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... or 5’-TCAAGGTCCCTGATAATTATGGCGA-3’) or scrambled siRNA (non-targeting control) using 6 μL Lipofectamine™ RNAiMAX (Invitrogen™ - Cat.# 13778075). After 24 h ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were cultured for 3 days under cold-shock conditions (32 °C/5% CO2) and in the presence of RevitaCell (ThermoFisher) and HDR enhancer (1 µM Alt-R HDR Enhancer v2 ...
-
bioRxiv - Neuroscience 2023Quote: ... BDNF_R: 5’-GCACTTGGTCTCGTAGAAGTA-3’) designed with the web-based software Primer3 and Syber Green PCR Master mix (Applied Biosystems, US). While ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was extracted in quadruplicate from male L3 larvae and 3-5 day old adults of the indicated genotypes and experimental groups using standard Trizol (ThermoFisher) extraction ...
-
bioRxiv - Molecular Biology 2023Quote: ... The rRNA-depleted small RNA samples were subsequently subjected to FastAP/PNK treatment to remove RNA 5’ and 3’ phosphates by incubating samples with 2.5 μl 10x FastAP Buffer (Thermo Fisher), 0.5 μl RNaseOUT (Thermo Fisher) ...
-
bioRxiv - Genetics 2023Quote: Adult females were collected and fed for 3-5 days before ovaries were dissected and fixed in 5.14% formaldehyde (Pierce, ThermoFisher Scientific) in phosphate buffered saline (PBS ...
-
bioRxiv - Neuroscience 2023Quote: ... pME-Dmist was recombined with 5’ (p5E-CMV/SP6) and 3’ (p3E-GFPpA) entry clones and destination vector (pDestTol2pA2) using Gateway Technology (Invitrogen LR Clonase II Plus enzyme Cat No ...
-
bioRxiv - Biochemistry 2023Quote: ... Cell proliferation was assessed at different time points (3, 5, 7 and 9 days) using AlamarBlue Cell Viability Reagent (Invitrogen) per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... The membrane was washed 3 times with 5% milk TBST and incubated with HRP-conjugated secondary antibodies (1:5000, 32230/32260; Invitrogen). Data were visualized using chemiluminescence detection on ChemiDoc Touch (Bio-Rad Laboratories).
-
bioRxiv - Immunology 2023Quote: ... and probe 5’-FAM-TCCAGCCTCCATAGCCGGGAAGG-TAMRA-3’ were used in a 25μL reaction with Supermix Platinum™ Quantitative PCR SuperMix-UDG (Invitrogen). The reaction was performed in a 96-well format for real time quantification on Applied Biosystems 7900HT Fast Real-Time PCR System ...
-
bioRxiv - Systems Biology 2023Quote: ... labeled with secondary antibodies (2 hrs at RT) and washed again in PBS (3 x 5 min at RT) before being mounted in Prolong Gold (Invitrogen by Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2023Quote: ... For the construction of the RNH2A KO clones, RNASEH2A (Chr19, exon 2) gRNA (5’-TAACAGATGGCGTAGACCAT-3’) was cloned into GeneArtTM CRISPR Nuclease Vector with OFP reporter (Invitrogen) following manufacturer’s protocol ...