Labshake search
Citations for Thermo Fisher :
1001 - 1050 of 10000+ citations for Fipronil Sulfone 3 Cyano Pyrazole 3 4 5 13C4 99%; 3 Cyano 5 15N2 98% 100 Ug Ml In Methanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... and reverse primer ENVN (5’ - TGCCAATCAGGGAAAAAGCCTTGTGTG - 3’. The envelope amplicons were purified, and ligated into pcDNA3.1D/V5-His-TOPO vector (Invitrogen). Chimeric envelope pseudoviruses were generated by swapping the V1V2 ...
-
bioRxiv - Genetics 2020Quote: ... Samples (5 μL each) were loaded into wells of a NuPAGE Tris-acetate 3 – 8% polyacrylamide gel (ThermoFisher Scientific) and electrophoresed for 60 min at 15 volts/cm ...
-
Molecular architecture determines brain delivery of a transferrin-receptor targeted lysosomal enzymebioRxiv - Neuroscience 2021Quote: ... Sections were rinsed in 1xPBS/0.05% Tween for 3 rounds of 5 minutes followed by incubation in secondary antibody (Invitrogen: Goat anti-rat Alexa Fluor 555 ...
-
bioRxiv - Cancer Biology 2021Quote: ... LDHC expression was quantified by specific 5′FAM-3′MGB Taqman gene expression primer/probe sets (Hs00255650_m1, Applied Biosystems). MAP1B expression was quantified using primers for SYBR-based qPCR (F ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Il36A_rev (5′-CAGTTCTTGGGTCAGAATGAGTG-3′) and subsequent cloning into pJET1.2/blunt vector as described by the manufacturer (ThermoFisher Scientific). The DNA fragment encoding mouse C/EBPβ residues 221–296 (bZIP domain ...
-
bioRxiv - Genomics 2021Quote: ... 0.5μM oligo-dT (IDT; 100uM 5′-biotin-ACGAGCATCAGCAGCATACGA-T30VN-3′) and 0.5mM dNTPs/each (Thermo Fisher; 25 mM each) and snap frozen at −80 °C ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The full structure of the NUKU2 transcript was determined with 5’ and 3’ RACE using the GeneRacer kit (Invitrogen), and testicle total RNA (Ambion ...
-
bioRxiv - Immunology 2022Quote: ... PBMCs were cultured at 37°C with 5% CO2 for 3 days in RPMI-1640 medium (Thermo Fisher Scientific) supplemented 10% FCS (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... for 15 minutes at room temperature and then washed 3 times for 5 minutes each with pH 7.4 Phosphate Buffered Saline (PBS) (Gibco). Cells were then simultaneously permeabilized and blocked with a solution of 0.25% Surfact-Amps X-100 (Thermo Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... Slides were rinsed 3 x 5 min and cell nuclei were labeled by DNA staining using Hoechst (Life Technologies) for 30 min at RT ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3.125 µM Oligo-dT30VN (IDT, 5′-AAGCAGTGGTATCAACGCAGAGTACT30VN-3′) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher, 4456740)) into 384-well hard-shell PCR plates (Biorad HSP3901 ...
-
bioRxiv - Microbiology 2024Quote: ... falciparum (3D7, Dd2, and HB3) parasites were cultured in 3-5% human O+ RBCs in RPMI-1640 (Gibco, 110875093) complete medium containing 0.5% Albumax-II (Invitrogen) ...
-
bioRxiv - Cell Biology 2024Quote: ... 0,5µM Smartseq3 OligodT30VN (IDT; 5’-Biotin-ACGAGCATCAGCAGCATACGAT30VN-3’) adjusted to RT volume and 0,5mM dNTPs/each (Thermo Fisher, #R0181). After cell sorting lysis plates were centrifuged before storage at -80°C ...
-
bioRxiv - Bioengineering 2022Quote: ... organoids were washed 3 times for 5 minutes each using PBS and mounted on glass microscope slides (Fisher Scientific). 90 μm Polybead Microspheres (Polyscience ...
-
bioRxiv - Cancer Biology 2023Quote: ... the sample was washed 3 x 5 min with PBS and mounted in Fluoromount-G (ThermoFisher, 00-4958-02). 15 samples per genotype were prepared and photographed using a tile scan at a confocal microscope Zeiss LSM780 (Zeiss ...
-
bioRxiv - Cell Biology 2023Quote: ... boiled at 95°C for 5 min and loaded into a NuPAGE 3-8% Tris-Acetate Gel (Thermo Scientific) along with HiMark™ Pre-stained Protein Standard (Thermo Scientific LC5699) ...
-
bioRxiv - Immunology 2023Quote: ... Slides were washed extensively (3 x 5 mins) in TBS-tween20 and incubated in appropriately labeled secondary antibodies (Invitrogen) for 1 h at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... Following preset incubation times (0, 0.5, 1, 3, or 5 h) cells were harvested by trypsinization (500 μl TrypLE, Gibco) for 5 min at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: HEK293 (ATCC CRL-1573) and HEK239A ΔGRK2/3/5/646 were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco 1196511) supplemented with 10% FBS (Hyclone SH30910.03) ...
-
bioRxiv - Molecular Biology 2023Quote: The cDNAs encoding MpRBOHB and its variants with 3 × FLAG tag at their 5’-end were cloned into the pcDNA3.1(-) vector (Invitrogen) for the quantitative measurement of ROS in HEK293T cells.
-
bioRxiv - Neuroscience 2024Quote: ... animals were incubated for 5 min in TO-PRO-3 Iodide (642/661) (Invitrogen, cat#T3605, 1:1000 dilution). And last ...
-
bioRxiv - Neuroscience 2024Quote: ... cells were washed 3×5 minutes and then mounted on Superfrost Plus slides (Fisher Scientific, Inc., Hampton, NH, USA), and cover-slipped with anti-fade medium (0.5% polyvinyl alcohol-DABCO ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... were maintained in a water jacketed 5 % CO2 incubator and passaged every 2-3 days using trypsin/EDTA (Gibco). 1E6 cells were seeded into 6 well plates ...
-
bioRxiv - Physiology 2024Quote: ... the peptides were concentrated on an Accalaim μ-Precolumn (0.5 mm × 3 mm, particle size 5 μm; Thermo Scientific) in the isocratic mode at a 10 μL/min flow for 5 min in the mobile phase C (2% acetonitrile ...
-
bioRxiv - Bioengineering 2020Quote: ... pure divinyl sulfone (12.5 ml, Fisher Scientific, Hampton, NH) was added to a sodium hydroxide solution (0.1 M ...
-
bioRxiv - Cancer Biology 2021Quote: ... endogenous peroxidases are blocked by incubating with 3% H2O2 (made from 30% H2O2, Fisher scientific, by diluting with methanol). Antigen retrieval was carried out using 0.001M EDTA buffer (pH 7.4) ...
-
bioRxiv - Cell Biology 2022Quote: ... 3.5 - 4 ml aliquots of the resulting 10,000xg supernatants were added up with 3-2.5 ml 1X PBS (Gibco, Carlsbad, CA, USA) to reach a final volume of 6.5 ml and were transferred on top of a 60% - 10% iodixanol gradient (Progen Biotechnik GmbH ...
-
bioRxiv - Biochemistry 2021Quote: ... or with 0.5 µg/ml doxycycline for 2-3 days) were combined in a 1:1 ratio and loaded with 5 µg/ml Indo-1 (Molecular Probes, AAT Bioquest, Sunnyvale, USA) and 0.04% of pluronic F-127 (AAT Bioquest ...
-
bioRxiv - Bioengineering 2023Quote: Single colonies were inoculated in 3 mL LB broth (10 g/L peptone, 5g/L yeast extract, and 5 g/L NaCl) (Thermo Fisher Scientific, Waltham, MA, USA) containing the respective antibiotics at 37°C at 220 rpm overnight ...
-
bioRxiv - Microbiology 2019Quote: ... Bacterial cells were lysed by suspending cells in 3 μL of 100 mg/ml RNase A (Ambion, AM2286) and ten μL of 100 mg/ml lysozyme (Sigma ...
-
bioRxiv - Biophysics 2022Quote: ... 3 mL of CO2-independent α-MEM culture medium (Thermo Fisher) was pipetted on top of the samples ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 ml of dissection medium containing 10X trypsin (15400-054, Invitrogen) at 37°C for 15 minutes was added ...
-
bioRxiv - Cancer Biology 2022Quote: ... digested in DMEM media containing 3 mg/ml Dispase II (Gibco) and 1mg/ml Collagenase IV (C5138 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Pellet was resuspended with warm 3 ml TrypLE express (Gibco, 12604021), incubated for 30 minutes at 37°C in a shaker at 180 rpm ...
-
bioRxiv - Biochemistry 2021Quote: ... the cells were washed 3 times with 2 mL DPBS (Gibco), scraped and lysed in 4% SDC buffer (4% sodium deoxycholate ...
-
bioRxiv - Physiology 2020Quote: ... and 3 mg/mL bovine serum albumin (BSA, Fisher Scientific, UK) for 1 h on ice ...
-
bioRxiv - Neuroscience 2021Quote: ... The culture slides were incubated with 3 ⎧g/ml aminin (Invitrogen) for 2 hours at 37°C before cell plating ...
-
bioRxiv - Bioengineering 2022Quote: ... an additional 3 mL DMEM/F12 medium were added (Life Technologies), followed by centrifugation for 5 min at 200 g ...
-
bioRxiv - Immunology 2024Quote: ... were coated with 3 µg ml-1 of streptavidin (Thermo Fisher) diluted in carbonate-bicarbonate buffer (E107 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 μg/ml anti-CD3 (Thermo Fisher Scientific, 16-0032-82) and 5 μg/ ml anti-CD28 (Thermo Fisher Scientific ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and plastic two-piece 3-mL syringes from Thermo Scientific (Canada). Smaller diluted bile samples for CS (30 μL ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 3 μg/ml of human α-CD3 (Thermo Fisher Scientific), 5 μg/ml of human α-CD28 (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2023Quote: ... plates were rinsed with 2-3 ml of PBS (Gibco, #10010023) and treated with 0,5 mL ReLeSR (Stemcell technologies ...
-
bioRxiv - Bioengineering 2024Quote: ... we neutralized acid-extracted Collagen I (3 mg/ml, Gibco, A1048301) using 10X DMEM and 2N NaOH ...
-
bioRxiv - Neuroscience 2021Quote: ... coated with 0.1% Poly-L- ornithine and Laminin (5 ug/mL; Thermo Fisher Scientific, 23017015). On DIV 5 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Transduced cells were selected by addition of 5-15 ug/mL blasticidin (Life Technologies, Inc) two days post-transduction ...
-
bioRxiv - Biochemistry 2022Quote: ... and then incubated with 5 ug/mL Alexa Fluor 350-conjugated Wheat Germ Agglutinin (Invitrogen) in PBS at room temperature for 10 minutes ...
-
bioRxiv - Genomics 2022Quote: ... media was changed to 1:1 KSR: N2B media with puromycin (5 ug/ml, Gibco). Puromycin was maintained in the media throughout the differentiation ...
-
bioRxiv - Cancer Biology 2023Quote: ... media was changed to 1:1 KSR: N2B media with puromycin (5 ug/ml, GIBCO). Puromycin was maintained in the media throughout the differentiation ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then passaged 1:3-1:6 every 2-3 days using Accutase (Gibco).