Labshake search
Citations for Thermo Fisher :
1351 - 1400 of 10000+ citations for Fipronil Sulfone 3 Cyano Pyrazole 3 4 5 13C4 99%; 3 Cyano 5 15N2 98% 100 Ug Ml In Methanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... placentas were chopped in 3 mL of Accutase solution (Thermo Fisher®) and incubated in 80RPM/min for 30 min at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... and 3 mg/mL collagenase type I (17100-017, Gibco, Carlsbad, CA) at 37 °C and 60 rpm for 16 h ...
-
bioRxiv - Microbiology 2021Quote: ... Stable transfectants were initially selected at 3 µg/ml Geneticin (ThermoFisher Scientific), and then maintained at 6 µg/ml Geneticin ...
-
bioRxiv - Biochemistry 2022Quote: ... a co-transfection mix was prepared with 3 mL of DMEM (Gibco) containing polyethylenimine (PEI ...
-
bioRxiv - Physiology 2022Quote: ... Fifty miligram of tissue was homogenized in 3 mL RIPA buffer (Invitrogen) with 1X Halt protease and phosphatase inhibitor (Invitrogen) ...
-
bioRxiv - Neuroscience 2021Quote: ... The shredded tissue was then incubated with 3 mL of HBSS (Invitrogen) for 5 min at 37 °C in a water bath ...
-
bioRxiv - Physiology 2020Quote: Acid extracted rat tail Type I Collagen (3 mg/mL; Thermo Fisher) was maintained at 4°C until polymerization ...
-
bioRxiv - Cell Biology 2020Quote: ... 2.5 μg pLVX vector diluted in 3 mL Opti-MEM (Thermo Fisher) containing 15 μL Lipofectamine 2000 (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were lysed with 3 ml IP lysis buffer (87787, Thermo Scientific) in the presence of protease inhibitor cocktail (Roche) ...
-
bioRxiv - Microbiology 2022Quote: ... Capsids were digested with 3 mg/mL proteinase K (Fisher Scientific: BP1700) in 100 mM KCl ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3 μg/mL anti-CD3 antibody (ThermoFisher Scientific, Cat#16-0038-85), 5 μg/mL anti-CD28 antibody (ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... washed twice with 3 mL ice-cold PBS (Thermo Fisher, cat. 10010023) to remove excess blood and transferred to a 5 mL glass beaker ...
-
bioRxiv - Immunology 2024Quote: ... cell suspension was mixed with 3 mL of ACK Lysing Buffer (Gibco). Remaining cells were stained and acquired using a FACSCalibur Cytek DxP 8 and analyzed with FlowJo ...
-
bioRxiv - Microbiology 2023Quote: ... were plated a day prior to transfection in 3 mL DMEM (Gibco), 10% FBS (Corning) ...
-
bioRxiv - Immunology 2023Quote: ... 3) Dyes: NucBlue Live Cell Stain (2 drops/ml, R37605, Molecular Probes), phalloidin-568 (A12380 ...
-
bioRxiv - Cancer Biology 2023Quote: ... in 3 ml of pre-cooled Advanced DMEM/F-12 (Gibco, #12634010), supplemented with Glutamax (Gibco ...
-
bioRxiv - Biophysics 2023Quote: ... and then treated with 3 ml of TrypLE (ThermoFisher, Waltham, Massachusetts, U.S.) at 37°C for 7 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 100 U/ml penicillin and 100 ug/ml streptomycin (Gibco; Cat#15140-122) at 37°C and 5% CO2.
-
bioRxiv - Cancer Biology 2022Quote: ... 100 U/mL penicillin 100 ug/mL streptomycin (1% Pen/Strep; Gibco, #15140-122), and 1 mM sodium pyruvate (Gibco ...
-
bioRxiv - Cell Biology 2024Quote: ... we changed the medium to a 1:1 mixture of KSR and N2B medium (DMEM F12, Thermo Fisher 11320033, with 1% GlutaMAX, 3% dextrose, N2-Supplement B, StemCell Technologies 07156, 5 μg/mL puromycin, Life Technologies A11138-03, and 2 μg/mL doxycycline). On day three ...
-
bioRxiv - Genetics 2021Quote: ... incubated for 5 minutes in 100μM LysoTracker Red DND-99 (Invitrogen, L7528) in PBS and mounted in PBS supplemented with 30% glycerol ...
-
bioRxiv - Genetics 2022Quote: ... and washed 3-4 times with fresh 10% RNA later solution (Thermo Fisher Scientific). After the last wash ...
-
bioRxiv - Zoology 2022Quote: ... The excised tissues were then placed (3-4 pieces) on gelatin (Attachment Factor, ThermoFisher)-coated dish (35 mm ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3-4 μl of samples were applied onto grids using a Vitrobot (Thermo Fisher). Grids were blotted with “595” filter papers (Ted Pella ...
-
bioRxiv - Genetics 2021Quote: Calu-3 cells were mock transfected with 4 μL of lipofectamine 3000 (ThermoFisher Scientific) in Opti-MEM (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: ... The medium was replaced after 3-4 hr with neurobasal medium (Gibco, Cat# 21103049) supplemented with 2% v/v B27 (Gibco ...
-
bioRxiv - Microbiology 2024Quote: ... cells were washed 3 times with DMEM and fixed with 4% paraformaldehyde (Thermo Fisher) at room temperature (RT ...
-
bioRxiv - Neuroscience 2023Quote: FOs from 2 or 3 independent differentiations were fixed using 4% paraformaldehyde (Thermo Scientific) in PBS (Gibco ...
-
bioRxiv - Molecular Biology 2023Quote: ... with 10% FBS and split every 3-4 days using TrypLE Express (Thermo Scientific). Low-passage ...
-
bioRxiv - Cancer Biology 2024Quote: ... and resolved on 3-8% or 4-12% gradient SDS-PAGE gels (Invitrogen, NuPAGE). After transfer to a polyvinylidene difluoride (PVDF ...
-
bioRxiv - Cell Biology 2024Quote: ... The cells were passaged every 3-4 days using 0.25% Trypsin-EDTA (Fisher Scientific) incubated at 37°C for 3-5 minutes to detach cells ...
-
bioRxiv - Neuroscience 2021Quote: ... filtered through a 70 µm nylon colander (Falcon) with 3-4 ml of Ca2+- and Mg2+-free HBSS medium containing 10 % fetal bovine serum (FBS, Gibco), 1 % MEM-vit (Gibco ...
-
bioRxiv - Cell Biology 2019Quote: ... Slides were washed 3 × 10 min with PBS and nuclei stained with 1 µg/mL 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen) in PBS for 15 min ...
-
bioRxiv - Cell Biology 2019Quote: ... and 100 µg/ml CHX) and centrifuged at 35,000 rpm for 3 hours at 4° C in a TH-641 rotor (Thermo Scientific) before collecting the monosome and polysome peaks (Fig 5E) ...
-
bioRxiv - Molecular Biology 2020Quote: ... reinhardtii cells were grown at room temperature for 3-4 days in the light in 20 mL of TAP media (ThermoFisher). The algae were collected by centrifugation at 10,000 x g for 1 min ...
-
bioRxiv - Biophysics 2022Quote: ... were washed three times in sterile PBS and opsonized overnight at 4°C in 3 mg/mL mouse IgG (Invitrogen). To remove excess antibody ...
-
bioRxiv - Biochemistry 2023Quote: ... 16 mL of HMA-10 buffer was added and the preparation was put on a shaking rocker for one hour at 4 °C with 3 units/mL Rnase-free Dnase (Ambion) added ...
-
bioRxiv - Bioengineering 2022Quote: ... 100 ug/mL streptomycin (Life Technologies, cat. code 15140148), 100 ug/mL Normocin (Invivogen ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... 100 ug/mL cycloheximide (Fisher Scientific, #50-200-8999), phosphatase inhibitor cocktail (Sigma-Aldrich ...
-
bioRxiv - Genetics 2021Quote: ... The membrane was hybridized with a biotin-conjugated telomere probe (5’-biotin-CACACCCACACCCACACC-3’) and was imaged using a Chemiluminescent Nucleic Acid Detection Module Kit (Thermo Scientific) and a Li-Cor C-DiGit Chemiluminescent Western Blot scanner.
-
bioRxiv - Neuroscience 2021Quote: ... and Standard Control (5’ CCTCTTACCTCAGTTACAATTTATA 3’) MOs (GeneTools) were diluted in distilled water and co-injected with Cascade Blue labelled dextran (Molecular Probes) into one- to two-cell wild-type (Tübingen ...
-
bioRxiv - Neuroscience 2020Quote: ... The slides were then washed in 1X PBS 3 times for 5 minutes before being incubated with Hoechst 33342 (Thermo Fisher) for 5 minutes before being washed again and coverslipped with prolong diamond (Life Technologies) ...
-
bioRxiv - Neuroscience 2021Quote: ... we designed more than 2 pairs of PCR primers in the 5’ and 3’ untranslated regions and inserted all resulting PCR products into pCR-Blunt-TOPO vector (Thermo Fisher). The TOPO-transcript vectors of the same gene were sequenced and compared to verify that no error was introduced to the coding sequence during reverse transcription ...
-
bioRxiv - Molecular Biology 2021Quote: ... a DNA oligo template (5’ TAATACGACTCACTATAGGGACACAAAACAAAAGACAAAAACACAAAACAAAAGACAAAAACA CAAAACAAAAGACAAAAAGCCTCTCCTTCTCTCTGCTTCTCTCTCGCTGTGTGCGTACAACTAGCT 3’) was PCR-amplified and then in vitro transcribed using the MEGAshortscript™ T7 Transcription kit (Invitrogen). An 11:7 ratio of the helicase RNA substrate to 5’ Alex Fluor 488 fluorescent oligo strand (Alexa Fluor 488/ AGCTAGTTGTACGCACAC ...
-
bioRxiv - Molecular Biology 2020Quote: ... We also sequentially removed the 5’ and 3’ viroid moieties from this latter plasmid via PCR with the phosphorylated primers (T4 polynucleotide kinase, Thermo Scientific) D3606 and D3285 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The MommeD43 mutation (A667E) was introduced by oligonucleotide-directed mutagenesis (5’ CTGTGCCCATTGAAAAGCTGGAT AGG; 3’ CCTATCCAGCTTTTCAATGGGCACAG) and ligated into the pFastBac Htb vector (Life Technologies). Bacmids were prepared using the Bac-to-Bac system ...
-
bioRxiv - Bioengineering 2022Quote: Primary neonatal cardiomyocytes were isolated from C57BL/6 mouse neonates on postnatal days 3-5 using the Pierce Primary Cardiomyocyte Isolation Kit (Thermo Fisher) as previously described (14) ...
-
bioRxiv - Genomics 2020Quote: ... cells were washed 3 times in 1xPBS for 5 minutes at room temperature and mounting was done in ProLong Gold with DAPI (Invitrogen, P36935). Images were collected on a LSM800 confocal microscope (Zeiss ...
-
bioRxiv - Genomics 2020Quote: ... 1,000,000 wild-type (J1) mESCs were transfected with 1µg of each 5’ and 3’ sgRNA-Cas9-mCherry plasmids using Lipofectamine 2000 (Thermo Fisher Scientific). After 24hrs of transfection ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1.5 μg of reporter plasmid and 15 ng of Cre-plasmid was mixed with 3 μL Lipofectamine LTX reagent (Invitrogen, #15338100), 1.5 μL PLUS reagent and 100 μL Opti-MEM following the manufacturer’s protocol ...