Labshake search
Citations for Thermo Fisher :
1101 - 1150 of 10000+ citations for Fipronil Sulfone 3 Cyano Pyrazole 3 4 5 13C4 99%; 3 Cyano 5 15N2 98% 100 Ug Ml In Methanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... A Lsm12-KO cell line of HEK293 cells was generated with Synthego’s chemically modified sgRNA 5’-CCAGAAUGUCCCUCUUCCAG-3’ and GeneArt Platinium Cas9 nuclease (ThermoFisher Scientific) that were transfected together into cells using Lipofectamine CRISPRMAX Cas9 transfection reagent (ThermoFisher Scientific).
-
bioRxiv - Genetics 2021Quote: The SNP STARRseq library (100ug plasmid DNA/replica) was transfected into LNCaP cells (5 × 107 cells/replica; 3 biological replicas) using the Neon Transfection System (Invitrogen). Cells were grown in RPMI 1640 medium supplemented with 10% FBS and collected 48hrs post-electroporation ...
-
bioRxiv - Molecular Biology 2021Quote: ... Individual reactions were heated to 65 °C for 5 min and transferred to ice for 3 min to facilitate annealing in SuperScript III reaction buffer (Invitrogen). After annealing ...
-
bioRxiv - Neuroscience 2022Quote: ... Recordings were made with patch pipettes (3-5 MΩ) containing aCSF and 10 µM alexa-594 (Thermofisher, Waltham, MA, USA) and CSFcNs were targeted under visual guidance using their fluorescence ...
-
bioRxiv - Neuroscience 2021Quote: ... We washed the cells 3 times for 5 minutes each with 1X PBS and mounted with ProLong Gold Antifade Mountant with DAPI media (Invitrogen) to preserve the cells for imaging ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were rinsed in Milli-Q water for 3 × 5 minutes and cover slipped with ProLong Gold Antifade (Invitrogen, P36930).
-
bioRxiv - Neuroscience 2021Quote: ... Tet-on 3’ UTR HP and 5’ UTR HP DG NSCs were brought in suspension by incubating with 0.25% trypsin (Gibco #15090) in Versene (Gibco #15040 ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was isolated from Hela cells (n = 3) subjected to EBSS-induced autophagy and treatment with 5 μM UNC0638 for 12 hours using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... Soluble material was incubated with 3-5 μg of antibody bound to 50 μl protein A or protein G Dynabeads (Invitrogen) and incubated overnight at 4 °C ...
-
bioRxiv - Cell Biology 2019Quote: ... The resulting PCR product was cloned between 5’ KpnI and 3’ EcoRI sites of the pMT/V5-His vector (Invitrogen). In-frame Tag-RFP-T gene was then introduced at the 3’ end of γ-tubulin gene between 5’ EcoRI and 3’ NotI sites ...
-
bioRxiv - Cell Biology 2019Quote: ... The resulting PCR product was then inserted into the 5’ SpeI and 3’ EcoRI sites of the pMT/V5 His-B vector (Invitrogen) containing in-frame mTurquoise2 gene at the 5’ end ...
-
bioRxiv - Microbiology 2019Quote: ... was carried out by taking 500 µl of the culture from respective time points into Eppendorf tubes and incubated them with 5 µM 3’-(p-hydroxyphenyl fluorescein (HPF; Invitrogen) (0.5 µl of HPF from 5 mM stock ...
-
bioRxiv - Molecular Biology 2019Quote: ... 3-9) or 5 µl (IP: Figure 2A-2C and input: Figure 2-9) RNAse A/T1 (Thermo Scientific #EN0551) and incubation the beads at 37°C for 30 minutes ...
-
bioRxiv - Molecular Biology 2019Quote: Three specific 5’ RACE primers and two 3’ RACE primers were designed according to the Race kit instructions (Invitrogen & Clontech) (Table S1) ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were washed 3 times with PBS (5 min, RT) and mounted using ProLong® Gold antifade mountant (ThermoFisher, P36930). STED microscopy was performed using a 100× objective on the STEDYCON 2-colour STED imaging system (Abberior Instruments) ...
-
bioRxiv - Neuroscience 2019Quote: ... A sequence including the zinc finger binding sequence (5’-GTCATCCTCATC-3’) (Gross et al., 2013; Perez et al., 2008) upstream of the hsyn1 promoter was synthesized (ThermoFisher) and inserted using the MluI and EcoRI restriction sites to generate pAAV-ZFBS-syn-PSD95.FingR-dNES-CaMPARI2_F391W_L398V-CCR5TC ...
-
bioRxiv - Cancer Biology 2019Quote: ... ssDNA (M13 primer ssDNA-M13 primer 5’-TGT-AAA-ACG-ACG-GCC-AGT-3’, paraformaldehyde (PFA) were purchased from ThermoFisher. PicoGreen variants were synthesized in house at ThermoFisher ...
-
bioRxiv - Microbiology 2021Quote: Approximately 200 ng of extracted vRNA was reverse transcribed using a universal 3′ primer (5′-AGGGCTCTTCGGCCAGCRAAAGCAGG) and Superscript III reverse transcriptase (RT) (Invitrogen). The RT product was diluted approximately 10,000-fold and used as a template for quantitative PCR (qPCR) ...
-
bioRxiv - Bioengineering 2020Quote: ... Separation was performed on an Aquasil C18 column (250 cm x 3 mm, 5 µm particle size; Thermo Fisher Scinetific) at a flow rate of 1 ml/min ...
-
bioRxiv - Immunology 2020Quote: ... was added using the primers 5’ GACCGTCTCGAGAAAAGAAAAGTCTTTGGACGATGTGAGC and 3’ GTGACTGAATTCTTACTAATGGTGATGGTGGTGATGGCCGCTCAGCCGGCAGCCTCTGA TCCAC and the product was subsequently cloned into the vector pPIC9K (Invitrogen) between the Xho I and EcoR I sites by doing a three-way ligation (EcoR I ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were washed at least 5 times 20 min and transferred to 0.25% PBT with 1:400 TO-PRO-3 (ThermoFisher #T3605) for 2 nights ...
-
bioRxiv - Cancer Biology 2021Quote: ... Slides were washed with 1X PBS 3 times for 5 minutes and then mounted with Prolong Glass Antifade mountant (Invitrogen). Confocal Z-stack images were acquired using Nikon SoRA spinning disk microscope ...
-
bioRxiv - Cell Biology 2021Quote: ... sections were washed at least 3-5 times with TBSTX buffer and incubated with the appropriate Alexa fluorescent secondary antibodies (Invitrogen). Sections were washed 3-5 times with TBSTX buffer and then mounted on Superfrost slides (Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were pelleted down at 2,500 rpm for 3 mins and were washed 5 times with ice-cold DPBS (Gibco #14200075). The pellets were finally dissolved in DPBS and were counted by haemocytometer using Trypan Blue stain (Gibco #15250061) ...
-
bioRxiv - Immunology 2021Quote: ... forward 5’-TAACCGGTATGGGCATACTGAGCTTTCT-3’ (contains the AgeI restriction site) and reverse 5’-TAGGATCCAATCCTGTTCTGGTCGTCG-3’ (contains the BamHI restriction site) and the PCR product was cloned into pCRBlunt (Invitrogen) and sequenced ...
-
bioRxiv - Biophysics 2021Quote: ... we wash the blot 3 times with TBST and soak for 5 min in chemiluminescent substrate (Thermo Scientific catalog # 34080).
-
bioRxiv - Microbiology 2021Quote: ... using a HA-specific primer (5’-GTCCTTGCGACTG-3’) and a RevertAid first-strand cDNA synthesis kit (Invitrogen, Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... using a HA-specific primer (5’-GTCCTTGCGACTG-3’) and a RevertAid first-strand cDNA synthesis kit (Invitrogen, Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... ISR1 CDS with a 5’ EcoRI restriction site and 3’ BamHI restriction site was amplified using Phusion (Thermo Fisher Scientific) and ISR1 start + EcoRI FOR and ISR1 no stop + BamHI REV primers (Table S1) ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were then washed 3 × (MBL2 wash buffer) and stained with DAPI (600 nM in MBL2 wash buffer; 5 min, RT; ThermoFisher) before imaging ...
-
bioRxiv - Cancer Biology 2020Quote: 1 μg total RNA from healthy and OS samples was used for 5’ and 3’ RACE reactions with the FirstChoice RLM-RACE kit (Ambion) according to manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... Total RNA was isolated from sorted 2-3×10^5 CD34+ cells using the mirVANA miRNA isolation kit (Thermo Fisher) and subsequently processed using the Small RNA Library Prep kit (Norgen Biotek) ...
-
bioRxiv - Cell Biology 2021Quote: ... so that 50 μg of total protein could be mixed with 5% Coomassie brilliant blue G-250 before loading on a 3-12% Bis-Tris BNE gel (Invitrogen). After electrophoresis (2.5 hr ...
-
bioRxiv - Cell Biology 2020Quote: ... slides were washed 3 times in PBST for 5 minutes each and mounted using ProLong Diamond Antifade Mountant (Invitrogen, P3696). Coverslips were carefully placed over the sections ...
-
bioRxiv - Bioengineering 2022Quote: ... cells were washed 3 x 5 min with PBS before adding secondary antibody (1:200 Alexafluor-488 goat anti-mouse, Invitrogen) and rhodamine phalloidin (1:100 ...
-
bioRxiv - Molecular Biology 2022Quote: ... NC) or plasmid with HAX1 gene with tag on 3’end or 5’end of the gene (LipofectamineTM2000, ThermoFisher Scientific). Cells were detached and seeded on 100mm plates to grow single colonies (selection ...
-
bioRxiv - Neuroscience 2022Quote: ... Coverslips were rinsed 3 times for 5 minute intervals with PBS and mounted on microscope slides (Fisher Scientific, 22-178277) using ProLong Glass Antifade Mountant (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5’L1-3’L2 orientation were inserted via recombination into a pCS2+ Gateway-converted vector (Custom vector conversion kit; Invitrogen). Details of the Gateway plasmid are available upon request ...
-
bioRxiv - Developmental Biology 2022Quote: ... F 5’-GAACTGTCCAGATGCCCTTCCAGTT-3’ and R 5’-GCATCTGGACAGTTCTGGGAAGCCCG-3’) was cloned by PCR and ligated into the pEF6/V5-His TOPO plasmid vector (Invitrogen). FBLN7-V5-His vector was transfected into CHO cells (FBLN7-CHO ...
-
bioRxiv - Immunology 2022Quote: ... complementary DNA (cDNA) was generated from extracted mouse plasma RNA using primer YB383 5’-TTTTTTTTTTTTTTTTTTTTTTTTRAAGCAC-3’ and enzyme Superscript III (Invitrogen) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... The membranes were again washed 3× in PBS for 5 min each and mounted onto slides using ProLong Gold Antifade (Invitrogen). Images of stained mTECs were obtained using an SP8 (Leica Microsystems ...
-
bioRxiv - Plant Biology 2022Quote: ... Rosettes were rinse 3 times in distilled water and stained 20 min in a 5% (v/v) Lugol’s iodine solution (Fisher Scientific). After 3 rinses in distilled water ...
-
bioRxiv - Neuroscience 2021Quote: ... Following secondary antibody incubation samples were washed 3 times for 5 minutes with PBS and then mounted on glass slides in ProLong Glass Antifade Mountant (P36984, Invitrogen) with a #1 coverslip ...
-
bioRxiv - Neuroscience 2021Quote: ... Then slides were washed 3×5’ in TBS and incubated in donkey-α-sheep-488 (1:500, Life Technologies, A11015) in TBS for 90’ ...
-
bioRxiv - Immunology 2021Quote: ... 4 million splenocytes cells were stimulated ex vivo for 3 hours at 5% CO2 at 37°C in Minimum Essential Media (Gibco) containing 10% fetal bovine serum (FBS ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and reverse (5’-ACAGGACATTGACCAACCCA-3’) primers (0.3μM) and 1X premixed Phusion Flash High-Fidelity PCR Master Mix (Thermo Scientific, France). Amplifications were carried out in a thermal cycler LifeEco (BIOER Technology ...
-
bioRxiv - Genetics 2022Quote: The cloned SNP STARRseq library (100ug plasmid DNA/replica) was transiently transfected into LNCaP cells (5 × 107 cells/replica; 3 biological replicas) using the Neon Transfection System (Invitrogen). Cells were grown in RPMI 1640 medium supplemented with 10% FBS and collected 48hrs post electroporation ...
-
bioRxiv - Biochemistry 2022Quote: ... Wild type wis1+ open reading frame or versions in which Methionine at 395 was substituted with alanine or glycine were synthesised by integrated DNA technologies (IDT) with PstI site at 5’end and KpnI site at 3’end and cloned into pJet1.2 (Thermo Scientific). Wild type wis1+ ORF was amplified by Phusion PCR from NT4 genomic DNA with primers containing PstI and KpnI restriction sites at 5’ end and 3’ end respectively ...
-
bioRxiv - Developmental Biology 2020Quote: ... for 3 to 5 min at 37°C and resuspended in differentiation medium N2B27 (Advanced DMEM F12, Neurobasal vol:vol (Life Technologies)) ...
-
bioRxiv - Neuroscience 2019Quote: ... and then transfected with 2.5 µg of donor DNA and 1.25 µg of each targeting construct (Supplemental Table 3) using Lipofectamine Stem (Invitrogen STEM00003) according to the manufacturer’s instructions ...