Labshake search
Citations for Thermo Fisher :
1101 - 1150 of 10000+ citations for Nucleic Acid Electrophoresis Gel since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... 300 µg/mL bromophenol blue) and subjected to electrophoresis on 15% polyacrylamide TBE-Urea gels (Invitrogen). Gels were stained briefly with 1X SYBR Gold (Invitrogen) ...
-
bioRxiv - Cell Biology 2019Quote: ... 100 µg were loaded onto a 1% agarose gel and ran on Owl™ EasyCast™ B1 Mini Gel Electrophoresis Systems (Thermo Scientific) at 4 °C ...
-
bioRxiv - Biochemistry 2022Quote: ... the PEG-tagged samples and the negative controls of the respective stable cell lines were resolved by denaturing gel electrophoresis on 3-8% Tris-acetate gradient protein gels (Thermo Fisher Scientific, EA0378BOX) using Tris-acetate-SDS running buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... and the soluble fractions were analysed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) on 6% Tris-Glycine gels (Life Technologies, Carlsbad, CA)64 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and analyzed by SDS-PAGE (SDS-polyacrylamide gel electrophoresis) using Novex™ 14% Tris-Glycine protein gels (Cat. #XP00145BOX, Thermo Scientific, MA, USA). Protein bands were visualized with Coomassie Brilliant Blue staining.
-
bioRxiv - Cancer Biology 2022Quote: ... The proteins in the lysates were separated by gel electrophoresis with Bolt™ 4-12% Bis-Tris Plus Gels (Invitrogen™, CAT: NW04122BOX) and transferred to Immobilon-FL PVDF Membranes (MilliporeSigma™ ...
-
bioRxiv - Microbiology 2023Quote: ... 20μg of protein was subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) on NuPAGE 4-12% Bis-Tris gels (Thermo Fisher Scientific #NP0329). The gel was blotted onto Immobilon-FL PVDF Membrane (Millipore #IPFL00010 ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was extracted from each cell sample using RecoverAll ™ Total Nucleic Acid Isolation Kit (Ambion Inc, Austin, TX, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... or by incubating at 37°C for 48h and subsequently adding 6 µM Hoechst 33342 nucleic acid stain (Thermo Fisher Scientific) as a background stain for high content imaging analysis ...
-
bioRxiv - Genetics 2021Quote: ... The membrane was hybridized with a biotin-conjugated telomere probe (5’-biotin-CACACCCACACCCACACC-3’) and was imaged using a Chemiluminescent Nucleic Acid Detection Module Kit (Thermo Scientific) and a Li-Cor C-DiGit Chemiluminescent Western Blot scanner.
-
bioRxiv - Microbiology 2019Quote: ... An aliquot of the purified nucleic acid was treated with DNase (Turbo DNA-free kit; Thermo Fisher Scientific, Waltham, MA, USA) and RNA was reverse transcribed to cDNA using SuperScript III Reverse Transcriptase Kit (Invitrogen ...
-
bioRxiv - Evolutionary Biology 2020Quote: Total nucleic acid was extracted from archived saliva swabs from Neotropical bats on a Kingfisher Flex 96 automated extraction machine (ThermoFisher Scientific) with the Biosprint One-for-all Vet Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2021Quote: ... was performed using double nucleic acid detection kit for respiratory syncytial virus (A/B) (Shenzhen shengkeyuan) with the ABI Q7 (Applied Biosystems). The reaction was conducted according to the manufacturer’s instructions with total volume of 20 μL.
-
bioRxiv - Genomics 2022Quote: ... 50 µg of purified nucleic acids were digested by a cocktail of restriction enzymes (EcoRI, HindIII, XbaI, SspI, BsrGI; FastDigest enzymes; Thermo Scientific) for 30min at 37°C in a total volume of 100 µL ...
-
bioRxiv - Cancer Biology 2020Quote: ... Neutrophils were treated for 3h at 37°C and 5% CO2 and then stained with 20uM SYTOX(tm) Green Nucleic Acid Stain for 10min (Thermofisher Scientific). Images and videos were taken using a Zeiss Axio Observer.Z1 coupled with incubation chamber (ZEISS) ...
-
bioRxiv - Bioengineering 2021Quote: Viral RNA was extracted from 200μl of VTM using the MagMAX™ Viral/Pathogen II (MVP II) Nucleic Acid Isolation Kit (Applied Biosystems) on the KingFisher™ Flex Purification System (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were washed once with excess FACS buffer and resuspended in 500µl of 1:2000 diluted Sytox Blue nucleic acid stain (Thermo Fisher #S11348) in FACS buffer ...
-
bioRxiv - Microbiology 2020Quote: ... Cultures were incubated with the compounds for 72 hrs before adding SYBR-gold nucleic acid stain (1:10000 dilution) (ThermoFisher Scientific) modified from 72 substituting SYBR-green for SYBR-gold ...
-
bioRxiv - Microbiology 2020Quote: ... and the pellets were resuspended in 1 ml staining buffer supplemented with 0.5 μM Sytox Green Nucleic Acid Stain (Molecular Probes, Life Technologies), followed by incubation in the dark for 5 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... Biotin labeld RNA mix (catalog no. 11685597910) was from Rhoche. Chemiluminescent nucleic acid detection module (catalog no. 89880) was from Thermo Scientific. ChIP assay kit (catalog no ...
-
bioRxiv - Microbiology 2022Quote: ... reverse transcription was first performed on the extracted nucleic acid with random hexamer primer using the first strand cDNA synthesis kit (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... RNA in the aqueous phase was collected and further purified using a KingFisher II automated nucleic acid extraction system (ThermoFisher Scientific) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: Total nucleic acids were extracted from whole blood samples using the MagMax™ 96 viral Isolation kit (Applied Biosystems, Vilnius, Lithuania), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were incubated with 0.5 µM Lipi-Deep Red neutral lipid stain (Dojindo #LD04-10) for 2 hr and 5 µg/mL Hoeschst 33342 nucleic acid stain (Invitrogen #H3570) for 30 min at 37°C ...
-
bioRxiv - Plant Biology 2021Quote: ... Total RNA isolated from a pool of 2-3 weeks old plants extracted by standard protocols (See nucleic acid extraction section) were taken for RNA ligations after DNase I treatment ((#EN0521, Thermo scientific). RNA adapters with a 5’ inverted dT modification (See Supplementary Table 1 ...
-
bioRxiv - Neuroscience 2021Quote: ... 25nM of labelled RNA was then bound to nucleic acid-compatible streptavidin magnetic beads using the Pierce Magnetic RNA-Protein Pull-down kit (ThermoFisher Scientific) and incubated with 100ug protein lysate from human brain overnight at 4°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... and each well was supplied with 100 µL of Annexin binding buffer supplied with 0.1 µL SYTOX™ Blue Nucleic Acid Stain (ThermoFisher Scientific) and 2 µL Annexin V Alexa Fluor 657 (ThermoFisher Scientific) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Concentration of nucleic acid samples were measured on a spectrophotometer and treated with DNase (TURBO DNA-free Kit, Life Technologies, AM1907).
-
bioRxiv - Evolutionary Biology 2019Quote: ... The nucleic acid yield and purity were determined by measuring the optical density at A260/280 using Nanodrop spectrophotometer (Thermo Scientific). RNA samples were treated with TURBO DNase (Life Technologies) ...
-
bioRxiv - Microbiology 2019Quote: ... Nucleic acids were treated with DNase for 40 min at 37°C using the DNA-free DNA Removal Kit (ThermoFisher Scientific) or with RNase A (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2021Quote: ... Quantification of the enzymatic activity (Figures 2d and 2e) was done using the fluorescence emission of SYBR I nucleic acid stain (Thermofisher Scientific). SYBR I was added to the samples after the reaction was completed and the fluorescence measured in a Real-time PCR machine (Rotor-Gene Q ...
-
bioRxiv - Genomics 2020Quote: The extraction of the viral nucleic acid from the nasopharyngeal specimen was performed using the PureLink™ Viral RNA/DNA Mini Kit (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... for 20 min before incubation overnight at 4°C in PBS-BR containing any of the following mAbs or reagents: DAPI nucleic acid (Molecular Probes), phalloidin Alexa fluor 488 (Molecular Probes) ...
-
bioRxiv - Microbiology 2022Quote: Total nucleic acids including viral RNA (vRNA) were extracted from nasal washes and were reverse transcribed using SSIV VILO (Invitrogen, USA) and the Uni12 primer (AGCAAAAGCAGG ...
-
bioRxiv - Cell Biology 2023Quote: ... was conducted on the cDNA using gag-specific primers (GGACCAAAGGAACCCTTTAGAGA; GGACCAACAAGGTTTCTGTCATC) in the presence of nucleic acid dye SYBR Green (Invitrogen, Europe). Standard curves were generated using cDNA synthesized from in vitro transcribed RNA ...
-
bioRxiv - Cell Biology 2023Quote: ... We observed that TAT-WT and TAT-R5K eGFP conjugates (but not eGFP alone) were contaminated with nucleic acids (A260nm signal on the Nanodrop (ThermoFisher Scientific) from the expression while eGFP alone was not ...
-
bioRxiv - Cell Biology 2023Quote: For flowcytometric quantification of GFP signal in induced 3D7-DiCre pFIO/pFIO+ strains 2.5 µl iRBCs were washed once with RT 0.9% NaCl solution (B. Braun GmbH) and stained with 5 µM SYTO 61 Red Fluorescent Nucleic Acid stain (Thermo Fisher Scientific) for 1 h at 37°C in 0.9% NaCl solution and washed once again afterwards at RT ...
-
bioRxiv - Genetics 2023Quote: ... The membrane was incubated with streptavidin-conjugated horseradish peroxidase and then with reagents of the Chemiluminescent Nucleic Acid Detection Module Kit (ThermoFisher, 89880). The membrane was then scanned with the use of a ChemiDoc XRS+ System (Bio-Rad).
-
bioRxiv - Immunology 2023Quote: ... samples were centrifuged for 2 minutes at 2000xg and supernatants were collected and processed using the Viral RNA/Pathogen Nucleic Acid Isolation kit and a KingFisher instrument (ThermoFisher Scientific), or an IndiMag pathogen kit (Indical Bioscience ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The gels were then rinsed three times in water for an hour each and later stained with SYBR gold nucleic acid stain (ThermoFisher Scientific)(DNA Stains | Thermo Fisher Scientific - ES ...
-
bioRxiv - Microbiology 2023Quote: ... the collection liquid of each individual sampler dedicated to nucleic acid analyses was filtered independently through 0.22 µm MCE membranes using sterile filtration units (Thermo Scientific Nalgene), in a laminar flow hood previously exposed to UV light for 15 min ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... We then pelleted and resuspended cells in sodium citrate and added 30 µL of 50 µM SYTOX green nucleic acid stain (Invitrogen S7020). Finally ...
-
bioRxiv - Bioengineering 2024Quote: ... we carefully aspirated the media from the microwells containing cancer spheroids and added 500 µl of RPMI media supplemented with a 1:5000 dilution of SYTOX™ Deep Red Nucleic Acid Stain dye (#S11381, Invitrogen) for tracking dead cells ...
-
bioRxiv - Cancer Biology 2024Quote: ... in the extracellular domain of the CaSR at a concentration of 5 μg/ml and counterstained with SYTO13 fluorescent nucleic acid dye (ThermoFisher, S7575) as previously described 33 ...
-
bioRxiv - Cell Biology 2024Quote: ... iRBCs were washed twice with media to remove extracellular merozoites before being aliquoted in triplicate into a 96-well U-bottomed plate and stained with the nucleic acid dye SYTO-61 (2 μM) (Thermo Fisher) for 15 minutes ...
-
bioRxiv - Neuroscience 2023Quote: The cell viability assay was conducted using SYTOX™ deep red nucleic acid stain for dead cells (Thermo Fisher Scientific, S11381), as per the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... DNA was isolated and purified using a liquid handler robot (MagMAX Microbiome Ultra Nucleic Acid Isolation Kit, Thermo Fisher Scientific, US). For quality control ...
-
bioRxiv - Bioengineering 2024Quote: Nucleic acids were extracted from 200 μL viral production samples with a PureLink Viral DNA/RNA kit from Invitrogen (Cat #12280050). Samples were processed according to the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The sfGFP purification samples were combined and analysed via sodium dodecyl sulphate (SDS)-polyacrylamide gel electrophoresis (PAGE) using 4–12% Bis-Tris gels (NuPAGE Novex, Thermo Fisher Scientific, MA, USA), followed by western blot analysis using a HRP-conjugated GFP-specific polyclonal antibody (1:4,000 dilution ...
-
bioRxiv - Cancer Biology 2020Quote: ... 10 of 50uL from the reaction volume was then heat-denatured in the presence of DTT and protein bands were detected by SDS-PAGE gel electrophoresis using a Tris-Glycine 10-20% gel (Thermo Fisher Scientific, Waltham, MA).