Labshake search
Citations for Thermo Fisher :
1001 - 1050 of 10000+ citations for Human integrin alpha 5 beta 3 His tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2021Quote: ... and further ligated into pcDNA 3.1 V5/His TOPO vector using pcDNA 3.1 V5/His TOPO TA cloning kit (Invitrogen). The ACRD etoll was then transferred to pGADT7-AD vector using Nde1 and BamH1 sites ...
-
bioRxiv - Cell Biology 2022Quote: ... The His SNX32ΔC protein bound to the lipids was detected by anti-His antibody [1:10,000 (Thermo Scientific)]
-
bioRxiv - Molecular Biology 2023Quote: ... ceSMSγ and ceSMSr cDNAs were cloned into yeast expression vector pYES2.1/V5-His-TOPO and mammalian expression vector pcDNA3.1/V5-His-TOPO (Invitrogen) as described previously(18).For expression studies in Drosophila S2 cells ...
-
bioRxiv - Microbiology 2019Quote: ... and 5 μg.L−1 of epidermal growth factor (EGF) human recombinant (Thermo Fisher Scientific) (Wu et al ...
-
bioRxiv - Bioengineering 2021Quote: ... 100 μL of 5 μg/mL fibrinogen from human plasma conjugated to AF488 (Invitrogen) was added to each well ...
-
bioRxiv - Cancer Biology 2021Quote: ... Mouse anti-Alpha-Smooth Muscle Actin (ACTA2) (ThermoFisher; 1:100), Rabbit anti-PDGFR beta (Abcam ...
-
bioRxiv - Cancer Biology 2021Quote: ... 20μg/mL TNF-alpha Monoclonal Antibody (28401) (ThermoFisher #MA5-23720) or Mouse IgG1 Isotype Control (MOPC-21 ...
-
bioRxiv - Genomics 2019Quote: ... rabbit α-CaMKII alpha (#PA514315, Thermo Fisher Scientific, 1:50), chicken α-GFAP (#ab4674 ...
-
bioRxiv - Cell Biology 2020Quote: Tumor necrosis factor alpha (TNF-α) was obtained from Gibco ThermoFisher (Gaithersburg ...
-
bioRxiv - Immunology 2021Quote: ... These cells were maintained using alpha-MEM medium (Gibco, Ireland) supplemented with platelet lysate ...
-
bioRxiv - Bioengineering 2021Quote: ... X-ray photoelectron spectroscopy (XPS, K-Alpha – Thermo Scientific, US) was used ...
-
bioRxiv - Bioengineering 2021Quote: ... and osteogenic media (OM) for MSCs (containing alpha-MEM (Gibco), 10% fetal bovine serum (Gibco) ...
-
bioRxiv - Neuroscience 2020Quote: ... Anti Alpha Tubulin Antibody Clone DM1A (Thermofisher cat no-62204), Tau Monoclonal antibody (T46 ...
-
bioRxiv - Cell Biology 2019Quote: ... alpha-tubulin DM1a (1:1000 for IF & WB) (ThermoFisher #62204); rabbit monoclonal anti-p60 EPR5071 ...
-
bioRxiv - Immunology 2019Quote: ... IL-1 alpha Mouse Uncoated ELISA Kit (ThermoFisher #88-501988); eBioscience Mouse IL-6 ELISA Ready-SET-Go! Kit (Fisher Scientific #50-112-8863 ...
-
bioRxiv - Immunology 2019Quote: ... and α-alpha Tubulin Clone DM1A (ThermoFisher Scientific, #62204, RRID:AB_1965960). Antibodies used for the blockade of B7-1- and B7-2-dependent CD28 costimulation were anti-mouse CD80 Clone 16-10-A1 (BD Pharmingen #553736 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... cells were cultured in MEM-alpha (Thermo Fisher, Cat#: 12561049) supplemented with 1% (v/v ...
-
bioRxiv - Physiology 2023Quote: ... alpha X (CD11c; M1, pro-inflammatory macrophages; Invitrogen; 1:300), and mannose receptor (CD206 ...
-
bioRxiv - Bioengineering 2023Quote: ... anti-mouse alpha-tubulin (1:100; A11126, ThermoFisher, MA, USA); anti-rabbit vinculin (1:50 ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-PKA alpha polyclonal antibody (Thermo Fisher, Cat. #PA5-17626), and anti-beta-actin (Santa Cruz Biotechnology ...
-
bioRxiv - Developmental Biology 2023Quote: ... The cells were cultured in Alpha MEM (Thermo Fisher, 12000063) supplemented with 2.2 g/L sodium bicarbonate (Corning ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Osteoblasts were maintained in alpha-minimal essential medium (aMEM) (Gibco) containing 10% FBS (Gibco) ...
-
bioRxiv - Bioengineering 2024Quote: hMSCs were culture expanded in MEM-alpha medium + GlutaMax (Gibco) supplemented with 10% FBS (Sigma Aldrich ...
-
bioRxiv - Immunology 2021Quote: ... on the QuantStudio 5 or QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific). Relative transcript levels were normalized to TATA-binding protein (Tbp ...
-
bioRxiv - Molecular Biology 2021Quote: ... and CAF-1 p60 (5′-AAUCUUGCUCGUCAUACCA-3′) were transfected using RNAi MAX (Invitrogen).
-
bioRxiv - Neuroscience 2020Quote: ... and 0.175 g/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Invitrogen). Alkaline phosphatase staining reaction was proceeded o/n at RT ...
-
bioRxiv - Genomics 2020Quote: ... or a positive control probe 5’-5Alexa488N/(ATA)8TUU (ATA)7-3’ (Invitrogen). Reactions were incubated in a water bath at 37°C for 2 hrs ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 mM succinimidyl 3-(2-pyridyldithio)propionate (SPDP) (Thermo Fisher Scientific, USA) in PBS (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: Non-targeting control (CTRL) (Dharmacon) 5’-UGGUUUACAUGUCGACUAA-3’ KIF18A (Silencer Select s37882 – Ambion)8 5’-UCUCGAUUCUGGAACAAGCAG-3’ RAD51 (Silencer Select s11735 – Ambion ...
-
bioRxiv - Bioengineering 2021Quote: ... or siRNA targeting CTNNB1 (siCTNNB1, targeting sequence 5′- CCACAGCUCCUUCUCUGAGUGGUAA -3’, ThermoFisher, Waltham, MA) were resuspended in 50 μL of Opti-MEM and incubated at room temperature for 30 min ...
-
bioRxiv - Immunology 2022Quote: ... and 5 mM succinimidyl 3-(2-pyridyldithio)propionate (SPDP, Thermo Fisher Scientific, USA) in PBS (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2019Quote: ... with 3 M Na-Acetate and linear polyacrylamide (5 mg/mL, Ambion®) overnight at −80°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3′-end fluorescent labeling of the RNAs with fluorescein-5-thiosemicarbazide (ThermoFisher Scientific) was done as previously reported (Grozdanov and Stocco ...
-
bioRxiv - Microbiology 2020Quote: ... 3 to 5 colonies were transferred in Mueller-Hinton broth (Thermo Scientific Oxoid) and adjusted to an optical density at 600nm (OD ...
-
bioRxiv - Immunology 2020Quote: Pieces of 3 mm3 tumors were submerged in 5 vol of RNAlater (Invitrogen) (n = 5 samples/group) ...
-
bioRxiv - Developmental Biology 2020Quote: 3 × 106 ESC cells were distributed to 5 12-well dishes (Thermo Scientific) with 5 × 105 mESC cells per well ...
-
bioRxiv - Immunology 2022Quote: ... 5 μl RNA (2ng/μg) and 3 μl of 5x Primer stock (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Amplifications were run on a QuantStudio 3 or 5 thermal cycler (Thermo Fisher) and results were analyzed using the instrument software ...
-
bioRxiv - Cell Biology 2023Quote: ... vector encoding a sgRNA targeting PAC (5′-TGTCGAGCCCGACGCGCGTG-3′) using Lipofectamine 2000 (Invitrogen). GFP positive cells were isolated by FACS two days after infection ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were passaged every 3-5 days using Accutase or ReleSR (ThermoFisher Scientific).
-
bioRxiv - Cancer Biology 2023Quote: 5’ and 3’ RACE was performed using the GeneRacer kit (Thermo Fisher Scientific), following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 × 10-4 M MTG and 5% Protein-Free Hybridoma Media II (Gibco).
-
bioRxiv - Physiology 2021Quote: 2-3 viable human slices were incubated with Fluo4-AM (6 μM, Invitrogen cat. No. F1221) for 1h in 3 mM HEPES buffer (125 mmol/l NaCl ...
-
bioRxiv - Microbiology 2021Quote: ... and human bronchial adenocarcinoma Calu-3 cells were propagated using Dulbecco’s modified Eagle medium (DMEM; Gibco) supplemented with 10% fetal calf serum (FCS ...
-
bioRxiv - Immunology 2023Quote: ... The supernatant was collected on day 3 and analyzed by human IL-2 ELISA Kit (ThermoFisher) according to the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2023Quote: The siRNA sequences targeting human 14-3-3β (GenBank accession number: NM_003404.4) and human 14-3-3σ (GenBank accession number: NM_006142.5) were synthesized by ThermoFisher Scientific Ink (Massachusetts ...
-
bioRxiv - Biochemistry 2024Quote: ... Human calpain-3 isoform_1 (NM_000070.3) was used as a template from which GeneArt (Thermo Fisher Scientific) synthesized the modified gene following codon optimization ...
-
bioRxiv - Neuroscience 2024Quote: Human adenocarcinoma lung epithelial (Calu-3) cells (ATCC, HTB-55) were maintained with RPMI (Fisher Scientific) supplemented with fetal bovine serum (FBS) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 1.3 mL Beta-mercaptoethanol 55 mM (Gibco 21985-023). Cells were split once (1/3 or 1/4 ...
-
bioRxiv - Microbiology 2020Quote: ... and 0.5 µM Beta-mecaptoethanol (Gibco CAT No.: 21985-023). THP-1 were seeded in 24-wells plate at 5 X 104 cells/well ...