Labshake search
Citations for Thermo Fisher :
1151 - 1200 of 10000+ citations for Human integrin alpha 5 beta 3 His tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: Cell viability was assessed using a Human caspase-3 (active) ELISA kit (#KHO1091; Thermo Fisher Scientific, MA) following manufacture’s protocols ...
-
bioRxiv - Immunology 2020Quote: ... 105 hCD3+ T cells were mixed with human T-Activator CD3/CD28 Dynabeads (Thermofisher, ratio 3:1) or PHA (1μg/mL ...
-
BCR analysis of single-sorted, putative IgE+ memory B cells in food allergy: an ephemeral existence?bioRxiv - Immunology 2019Quote: ... Wells were washed 3 times and incubated with 1 μg/ml biotinylated anti-human IgE (A18803, Invitrogen) in 1% skim milk for 2 hours at room temperature ...
-
bioRxiv - Neuroscience 2022Quote: ... HLA-DR Antibody (Monoclonal Rabbit Anti-Human, Citrate Buffer HIER, dilution 1:50 Clone: LN-3, Invitrogen, Thermo Fisher Scientific ...
-
bioRxiv - Pathology 2024Quote: Gene expression on human cells and tissue was quantified using TaqManTM assays (Fisher Scientific, Supplementary Table 3) and Luna® Universal qPCR Master Mix (M3003E ...
-
bioRxiv - Neuroscience 2023Quote: Passage matched (±3) human induced pluripotent stem cells (hiPSCs) were cultured in StemFlex media (Life technologies #A3349401) on Matrigel (Corning ...
-
bioRxiv - Cell Biology 2020Quote: ... or DiD (1,1’-dioctadecyl-3,3,3’,3’-tetramethylindodicarbocyanine perchlorate, aka DiIC18(5)) (Thermo Fisher #D307) at a final concentration of 4 μg/mL ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were washed 3 times in 5% Bovine Serum Albumin (BSA; ThermoFisher Scientific, 11423164) in PBS then incubated with primary antibody to H2AX (Ser139) ...
-
bioRxiv - Genomics 2019Quote: ... using TVN PCR reverse primer (5’-CAAGCAGAAGACGGCATACGATTTTTTTTTTTTTTTTTTVN-3’) and SuperScript III Reverse Transcriptase (Invitrogen), and then the reaction was stopped by heating at 70°C for 15min ...
-
bioRxiv - Cell Biology 2019Quote: ... 3 min each) and digested for 5 min with proteinase K (10μg/mL; Ambion). Tissue sections were allowed to hybridize overnight in a humid chamber at 65°C with 1 ng/µL of sense (negative probe ...
-
bioRxiv - Neuroscience 2019Quote: ... After 3 washes Hoechst 33258 nuclear stain (ThermoFisher H3569, 1:1500 for 5 min) was used to counter stain the nuclei ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 μg mtDNA were digested with 3 ul DraI Fastdigest restriction enzyme (Thermo Scientific) at 37°C for 3h and extracted with 1 volume phenol-chloroform ...
-
bioRxiv - Microbiology 2022Quote: ... FAM-5=CAT CCA ATC AAA GAC ATT GCG A 3=-TAMRA (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Neuroscience 2021Quote: ... and 2-(4-Iodophenyl)-3-(4-nitrophenyl)-5-phenyltetrazolium Chloride (INT, #I00671G, Fisher Scientific).
-
bioRxiv - Cell Biology 2021Quote: ... Coverslips were washed 3 × 5 min and mounted on slides using Prolong Gold (Invitrogen). Deconvolution wide-field microscopy was performed using the DeltaVision Elite system equipped with an NA 1.42 60x PlanApo objective (Olympus ...
-
bioRxiv - Developmental Biology 2022Quote: ... zLL 5’- and 3’- RACE PCRs were performed using the GeneRacer core kit (Invitrogen). Total RNA (2 µg ...
-
bioRxiv - Cell Biology 2022Quote: ... CCDC66 was depleted using an siRNA with the sequence 5′-CAGTGTAATCAGTTCACAAtt-3′ (Thermo Scientific). Silencer Select Negative Control No ...
-
bioRxiv - Cell Biology 2023Quote: ... The following siRNA target sequences were used: GTPBP5 siRNA: 5’-CGGUGGACACGUCAUUCUGTT-3’ (134621, Ambion); GTPBP7 siRNA ...
-
bioRxiv - Cell Biology 2023Quote: ... CCDC15 was depleted using an siRNA with sequence 5′-GCAGUACCUGAGACAUAGAtt-3′ (Ambion, Cat. # s36888). For depletion of POC5 ...
-
bioRxiv - Biophysics 2023Quote: ... 2’(3’)-O-(2,4,6-trinitrophenyl)-adenosine 5’-triphosphate (TNP-ATP) was purchased from Invitrogen as a trisodium salt and stored in the dark at -20 °C at 10 mg/ml_ ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were passaged every 3-5 days as necessary using 0.5mM EDTA (Thermo Fisher). All staining and qPCR experiments included in Figure 1 were carried out in H1 and H9 stem cells ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5’ TCTTGCGGCTTTGTTGACAC 3’) using SYBR™ Green PCR Master Mix (Applied Biosystems, Bedford, MA). The quantities measured by real-time PCR were normalized to the Rpl13 (5’GGCGGACCGATTCAATAAGGTTCTGATCATTG 3’ ...
-
bioRxiv - Cell Biology 2024Quote: ... si-PRELID1: 5’-CCCGAAUCCCUAUAGCAAA-3’) were transfected using Lipofectamine RNAiMAX (Thermo Fisher Scientific, 13778075). Assays were normally carried out 48 h after transfection ...
-
bioRxiv - Genomics 2024Quote: ... and a QuantStudio 3 or QuantStudio 5 Real-Time PCR instrument (Applied Biosystems™). Primers used for qPCR are listed in Suppl ...
-
bioRxiv - Immunology 2024Quote: ... tonsils were rinsed 3 x 5 minutes with 1X PBS (10010023, ThermoFisher Scientific, USA) without agitation ...
-
bioRxiv - Developmental Biology 2021Quote: ... alpha-smooth muscle actin (1:500; Thermo Fisher Scientific, MA1-06110), ACE2 (1:100 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Mouse Aspn expressing CHO cells were cultured in Alpha MEM (Gibco) medium supplemented with 10% Dialyzed serum (Sigma) ...
-
bioRxiv - Genomics 2020Quote: ... mouse anti-alpha-tubulin (A11126, Thermo Fisher Scientific, Waltham, MA, USA), rabbit anti-VWF (Dako ...
-
bioRxiv - Molecular Biology 2021Quote: ... Mouse IFN-alpha 2 (Ifna2) recombinant protein was purchased from Affymetrix eBioscience (catalog #14-8312) ...
-
bioRxiv - Developmental Biology 2019Quote: OP9 cells were grown in alpha-MEM medium (Gibco #22561-021), containing 20% of fetal bovine serum (LGC ...
-
bioRxiv - Genomics 2019Quote: ... centrifuged and resuspended in Minimum Essential Medium (MEM) alpha (Gibco, #32561037) supplemented with 5% human platelet lysate (Cook Regentec ...
-
bioRxiv - Genetics 2020Quote: ... and a Phospho-IkB alpha (Ser32, Ser36) eFluor 660 antibody (ThermoFisher) with an FMO (fluorescence-minus-one ...
-
bioRxiv - Cell Biology 2020Quote: ... Anti IL-1 alpha (Thermo Fisher Scientific; Cat.# 11-7118-81).
-
bioRxiv - Cell Biology 2021Quote: ... hMSC were routinely cultured in MEM-alpha medium (Gibco#A10490-01) supplemented with 16% FBS (Gibco#16000 ...
-
bioRxiv - Cell Biology 2022Quote: ... the medium was exchanged everyday with Minimum Essential Medium Alpha (Gibco) containing 10% knockout Serum Replacement (Gibco ...
-
bioRxiv - Cell Biology 2022Quote: ... The cells were grown in MEM alpha medium (Thermo Fisher Scientific) supplemented with 10% fetal bovine serum (FBS) ...
-
Kinetochore- and chromosome-driven transition of microtubules into bundles promotes spindle assemblybioRxiv - Cell Biology 2022Quote: ... rat anti-alpha-tubulin YL1/2 (MA1-80017, Invitrogen, CA, SAD), diluted 1:500 ...
-
bioRxiv - Cell Biology 2022Quote: ... the marrow was flushed out with MEM-alpha (Gibco/Life Technologies), supplemented with 15 % FCS and 1% Penicillin-Streptomycin ...
-
bioRxiv - Cell Biology 2022Quote: ... the marrow was flushed out with MEM-alpha (Gibco/Life Technologies), supplemented with 15 % FCS and 1% Penicillin-Streptomycin ...
-
bioRxiv - Molecular Biology 2021Quote: ... WM115 was cultured in Minimum Essential Media-Alpha (MEM-α) (Invitrogen) supplemented with 1% penicillin-streptomycin (Gibco ...
-
bioRxiv - Molecular Biology 2020Quote: ... BHK-21 cells were maintained in Alpha MEM (22561-021, Gibco) supplemented with 5% foetal bovine serum (F7524 ...
-
bioRxiv - Cancer Biology 2022Quote: ... PE-Cyanine7_TNF alpha (1:100, Thermo Fisher Scientific, #25-7423-82)
-
bioRxiv - Pathology 2019Quote: ... then washed once with culture media (MEM alpha with nucleosides [Gibco catalog #12571-063] + 10% heat-inactivated fetal bovine serum + 1X penicillin/streptomycin + 10 μg/mL gentamycin + 2 μg/mL ciprofloxacin + 2 μg/mL ceftazidime) ...
-
bioRxiv - Cancer Biology 2020Quote: ... overnight at 4 °C and alpha-Tubulin (Invitrogen, 11224-1-AP) for 1-2 hours at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: Differentiation was induced in MEM alpha (11900-024, Thermo Fisher Scientific) containing 10% FBS (10437-028 ...
-
bioRxiv - Pathology 2019Quote: ... anti-alpha smooth muscle actin antibody (1:200, 180186; Life technologies), anti-CD31 (1:100 ...
-
bioRxiv - Bioengineering 2020Quote: ... XPS was performed using a K-Alpha apparatus (Thermo Fisher Scientific), with a micro-focused monochromatic Al Kα source (X-ray energy = 1486.6 eV ...
-
bioRxiv - Cell Biology 2021Quote: ... and MRC5-SV in alpha-MEM /Glutamax with 10% SVF (GIBCO) at 37°C in a humidified incubator in an atmosphere containing 5% CO2 (Panasonic MCO-19AIC-PE) ...
-
bioRxiv - Bioengineering 2022Quote: ... 2) alpha-SMA-eFluor660 (1:150; ThermoFisher Scientific; 50-9760-82), TGF-beta-PE (1:100 ...
-
bioRxiv - Neuroscience 2023Quote: ... 1/500 diluted alpha-synuclein monoclonal antibody (Syn 211, Thermofisher, AHB0261) prepared in intracellular staining buffer (ISB ...