Labshake search
Citations for Thermo Fisher :
851 - 900 of 10000+ citations for Human integrin alpha 5 beta 3 His tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... CDC20 was depleted using siRNA oligo #14 5’-CGGAAGACCUGCCGUUACA-3’ (ThermoFisher). siRNA oligos for PP2A-B55 and PP2A-B56 have been described (Hayward et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... 3-5 × 105 cells were settled on Polysine Slides (Thermo Fisher), fixed with 4% ...
-
bioRxiv - Neuroscience 2020Quote: ... FIVNC-555p (5’-FAM-CATGGCCACATTAATAATGG CGCA -TAMRA-3’ (Applied Biosystems, CA). These reactions were performed with a Bio-Rad iCyclerTM iQ and analyzed using the manufacturer’s software ...
-
bioRxiv - Cell Biology 2022Quote: ... DLP1-sense strand: 5’-UCCGUGAUGAGUAUGCUUUdTdT-3’ 31 (Ambion, Austin, TX, USA).
-
bioRxiv - Cancer Biology 2019Quote: ... 5’-CAGGGGTGCAGCTTGATTTC-3’ 7500 Fast Real-Time PCR System (Applied Biosystems) using optimized conditions for SYBRGreen I dye system ...
-
bioRxiv - Cell Biology 2020Quote: ... siRNA against MyoVa was obtained from Invitrogen (s9207, 5’ GUAUAGUCCUAGUAGCUA 3’) as this was shown to work well by Wu et al (2018) ...
-
bioRxiv - Immunology 2020Quote: ... Reactions were run on a Quantstudio 3 or 5 instrument (ThermoFisher). Cycling conditions for Quantifast reagents were ...
-
bioRxiv - Genomics 2021Quote: ... Linker oligo sequences were: 5’ – TTCAGACGTGTGCTCTTCCGATCTNNNNNNNNNNCAGGCTACTCCGCTTAAGGGAC-3’ (linker 1, Invitrogen, UK) and 5’-GTCCCTTAAGCGGAGTAGCCTG/3AmMO/-3’ (linker 2 ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were passaged every 3-5 days using TryplE (Gibco 12604054). Naïve and primed hPSCs were expanded and induced into different lineages in a 5% CO2 incubator at 5% O2 at 37C.
-
bioRxiv - Neuroscience 2023Quote: ... or CRMP2 siRNA (5′ GTAAACTCCTTCCTCGTGT-3′; obtained from Thermo Fisher Scientific) using the 4D-Nucleofector (P3 Primary Cell Solution ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 days after transfection by 5 µl of lipofectamine 2000 (Invitrogen) with 2 µg of the plasmid and regularly re-sorted to maintain expression of myr/palm-mCherry.
-
bioRxiv - Microbiology 2023Quote: ... HSV-1 Probe FAM-5’-CGGCCCAACATATCGTTGACATGGC-3’-MGBNFQ (Thermo Fisher Scientific). The efficiency of each round of PCR was determined using 10-fold dilutions of Topo TA plasmids (Invitrogen AB ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 5’- TTGGATCAGCTCAGACATATT-3’ or a nonspecific “scrambled” control (Invitrogen, United States). 72 hours after transfection ...
-
bioRxiv - Immunology 2022Quote: Expression vectors for human His-NLRP1PYD (aa 1-92) and GST-NLRP1PYD were generated by Gateway cloning with destination vector pDEST17 (Thermo Fisher Scientific) and a customized destination vector based on pGEX-2T (a kind gift of Mikko Taipale ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmid pcDNA4-B–hVMP1–V5/His was obtained by inserting the human VMP1 sequence (NM_030938.5) into pcDNATM4/V5-HisB (Invitrogen catalog number V861-20). pLenti–hVMP1–FLAG was obtained by inserting the oligonucleotide MCS-flag into pENTR1A (Addgene Plasmid #17398) ...
-
bioRxiv - Immunology 2023Quote: ... mammalian expression constructs carrying C-terminal 6X-His tagged gene of interest (HpARI1-3, or ST2 ectodomain) were transfected individually into Expi293F cells (Thermo Fisher) using the Expifectamine transfection kit (Thermo Fisher) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Tgfβ-3(Cat# Mm00436960) alpha-SMA (Cat# Mm00725412) and Vegf (Cat# Mm00437306_m1) Single Tube TaqMan® Gene Expression Assays (Life Technologies Thermo Fisher Scientific) were used ...
-
bioRxiv - Physiology 2021Quote: ... transferred and blotted with Peroxisome proliferator-activated receptor alpha (PPARα, ab 215270), endothelial nitric oxide synthase (eNOS, sc-376751) and Glyceraldehyde 3-phosphate dehydrogenase (GAPDH, Thermo Fisher, #10941-1-AP) antibodies as described [65] ...
-
bioRxiv - Developmental Biology 2023Quote: ... ATTO 550+ cells were sorted by flow cytometry and the 3% most positive cells were seeded at 1 cell per well in alpha minimal essential medium (αMEM, Thermo Fisher Scientific, Waltham, MA) containing 10% fetal bovine serum (FBS ...
-
bioRxiv - Molecular Biology 2023Quote: The RNA of 500 µL iRBCs at 3-5% parasitaemia was isolated using 3 mL TRIzol reagent (Invitrogen) followed by phenol-chloroform phase separation ...
-
bioRxiv - Molecular Biology 2021Quote: ... The ovaries were collected in oocyte manipulating media [alpha Minimum Essential Medium alpha (αMEM) + GlutaMax media (Gibco, Life Technologies, Carlsbad, CA) supplemented with 25 mM HEPES (Gibco)] and punctured repeatedly with a 30-guage needle to release the cumulus-oocyte complexes (COCs) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The ovaries were collected in oocyte manipulating media [alpha Minimum Essential Medium alpha (αMEM) + GlutaMax media (Gibco, Life Technologies, Carlsbad, CA) supplemented with 25 mM HEPES (Gibco)] and punctured repeatedly with a 30-guage needle to release the cumulus-oocyte complexes (COCs) ...
-
bioRxiv - Bioengineering 2023Quote: ... and CD90 were isolated from subcutaneous fat of adult NGL mice and cultured in Minimum Essential Medium Alpha (alpha-MEM; Mediatech, Inc.) containing 10% fetal bovine serum (FBS; Life Technologies) as previously described.22,30 Macrophages were prepared from bone marrow monocytes of adult NGL mice and cultured in a macrophage culture medium containing 10% conditioned medium from L929 cell culture ...
-
bioRxiv - Biophysics 2020Quote: ... while hNAA25 contained a Tobacco-etch virus (TEV)-cleavable N-terminal 6xHis-tag. Human NatB complex (hNAA201-163/hNAA25FL) was obtained by coexpressing these two plasmids in Sf9 (S. frugiperda) cells (ThermoFisher, cat# 12659017), and purified as described previously[35] ...
-
bioRxiv - Microbiology 2020Quote: ... human lung adenocarcinoma Calu-3 cells (ATCC; HTB-55) in MEM (Gibco; #11095-080) containing 10% FBS ...
-
bioRxiv - Immunology 2023Quote: ... primary human foreskin fibroblasts (HFFs) in 3 mL of DMEM (Thermo Fisher Scientific, 11965118) +10% FBS ...
-
bioRxiv - Plant Biology 2021Quote: ... Expression vectors containing the promoter-gene-fluorescent tag cassette or 3’UTR were obtained by using LR clonase-based three-fragment recombination system (Invitrogen®), the pB7m34GW/pH7m34GW/pK7m34GW/pS7m43GW/ pLOK180_pR7m34g (gift from L ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 µg of an HA-tag antibody (MBL, M132-3) was mixed with 20 µL of Dynabeads Protein G (Invitrogen, #10004D) and subsequently added to extracts ...
-
bioRxiv - Microbiology 2022Quote: ... Surface PCDH1 was stained using human anti-EC7 mAb-3677 (5 µg/mL) followed by anti-human Alexa FluorTM 555 (ThermoFisher) for 1 h at 4°C each ...
-
bioRxiv - Microbiology 2022Quote: ... The F gene was PCR amplified using primers RSV F 5’ (5’GCAAGGATTCCTTCGTGAC3’) and RSV F 3’ (5’CACACCACGCCAGTAG3’) and Phusion High-Fidelity DNA Polymerase (Thermo Fisher Scientific). Sanger sequencing was performed by Elim Biosciences.
-
bioRxiv - Molecular Biology 2022Quote: ... with FLAG sequence flanking at 5’ end of the primer and cloned in Hind III and Xba I site of pCDNA3.1V5-His (Invitrogen, USA). Clones were sequenced with T7 and BGH primer using ABI BigDyeTerminator V3.1 cycle sequencing kit followed by automated sequencing in ABI 3130 Genetic Analyzer according to manufacturer’s protocol.
-
bioRxiv - Biochemistry 2024Quote: ... C2C12 cells transfected with EGFP-HRas WT/C181S/C184S in 35mm dishes were treated with 15d-PGJ2-Biotin (5 µM) in DMEM Hi Glucose medium (Gibco) supplemented with 1% Penicillin-streptomycin-Glutamine (Gibco ...
-
bioRxiv - Developmental Biology 2022Quote: ... On day 5, aggregates were transferred to MK10 medium (Minimum Essential Medium alpha [α-MEM, Thermo Fisher Scientific], 10% KSR (Thermo Fisher Scientific), 55 μM 2-mercaptoethanol ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were cultured in a humidified atmosphere of 5% CO2 and 95% air at 37°C in an alpha modification of Eagle’s medium (Invitrogen Life Technologies, Carlsbad, CA, USA) supplemented with 10% FBS ...
-
bioRxiv - Microbiology 2021Quote: ... were isolated from the periodontal ligament tissues (cells from 5 individuals were pooled to offset individual differences) and maintained in alpha minimal essential medium (α-MEM, GIBCO Life Technologies) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2019Quote: Recombinant His-tagged EB1-GFP and His-tagged SEPT5 were transformed into E.coli BL21 (DE3) (Invitrogen). Bacterial cultures were grown to OD600 of 0.6-0.8 and induced with 0.2 mM IPTG for 16 h at 18°C for His-tagged-EB1-GFP or cultures were grown to OD600 of 0.4-0.6 and induced with 1 mM IPTG for 5 h at 23°C for His-tagged SEPT5 ...
-
bioRxiv - Neuroscience 2023Quote: ... SH-SY5Y cells were transfected with either an empty vector or with a vector expressing His-tagged human p35 (gift from Dr. Harish Pant) using Lipofectamine 3000 (Life Technologies, Carlsbad, CA). Two days after the transfection ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Immunology 2022Quote: ... where the integrin expression of living (DAPI negative) F4/80-expressing cells (1:100, Invitrogen) was analyzed ...
-
bioRxiv - Cancer Biology 2022Quote: ... Integrin-β2 recombinant protein complexes were immobilized on Maxisorp Immuno plates (ThermoFisher, 12-565-135) and used for positive binding selections with library phage pools that were first exposed to neutravidin coated wells to deplete nonspecific binders ...
-
bioRxiv - Biochemistry 2022Quote: ... Purified integrins were labelled with Alexa Fluor 647 succinimidyl ester following the manufacturer’s protocol (Thermofisher). Integrins were frozen in liquid nitrogen and stored at −80◦C in a buffer containing detergent (20 mM Hepes pH 7.5 ...
-
bioRxiv - Cell Biology 2022Quote: ... TcBDF2W92AFw (5’CGACTCCGCTGCGGTTAAAG-3’) and TcBDF2W92ARv (5’-CTTTAACCGCAGCGGAGTCG-3’).The PCR products were first cloned into the pCR2.1-TOPO vector (Invitrogen) and sequenced ...
-
bioRxiv - Neuroscience 2020Quote: ... total RNA was reverse-transcribed with 0.5ug of poly (T) adaptor containing a 5’-end universal tag sequence and SuperScript™ II Reverse Transcriptase (Thermofisher). Specific miRNA primers ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were washed three times for 5 minutes with PBS before incubation with streptavidin with fluorescent tag (Alexa Fluor 647 – Thermofisher) in blocking solution at 1:1000 dilution for 1.5hrs ...
-
bioRxiv - Plant Biology 2021Quote: ... The membranes were blocked with 5% fat-free milk and thereafter probed with primary antibodies 6xHis Tag Monoclonal Antibody (Invitrogen) followed by incubation with horseradish peroxidase-labeled secondary antibody ...
-
bioRxiv - Cancer Biology 2022Quote: ... and rotated at 4°C overnight with 2-5 ug of antibody (H3K27ac, Active Motif Cat #39133; V5 tag, ThermoFisher #R960-25 ...
-
bioRxiv - Physiology 2023Quote: ... The sequence containing the complete open reading frame of mouse PNPLA3 fused at the 5’ end with sequence of a FLAG or Myc tag was amplified by PCR using Phusion DNA polymerase (ThermoFisher), and then cloned into DUAL2-CCM adenoviral shuttle vector (Vector Biolabs ...
-
bioRxiv - Molecular Biology 2021Quote: ... anti-His (Thermo Fisher scientific, rd230540a), anti-EZH2 (Cell signaling #5246 ...
-
Map7D2 and Map7D1 facilitate microtubule stabilization through distinct mechanisms in neuronal cellsbioRxiv - Cell Biology 2022Quote: ... pcDNA3.1/V5-His (Thermo Fisher Scientific), pCLXSN-GFP (Reiley et al 2005) ...
-
bioRxiv - Cancer Biology 2020Quote: ... supplemented with 10% HI-FBS (Gibco) at 37°C in the presence of 5% CO2 ...