Labshake search
Citations for Thermo Fisher :
1001 - 1050 of 10000+ citations for 5 Isobutylcyclohexane 1 3 dione 98% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2022Quote: ... R:3’-UUGAACGUCACUAUAUUAACUGUUGUA-5’) dicer-substrate siRNA (DsiRNA) (20 nM, Integrated DNA Technologies, Coralville, IA) using Lipofectamine 3000 transfection reagent (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... Peptides were separated using 50 cm Acclaim PepMap 100 analytical column (75 μm ID, 3 μm C18) in conjunction with a Pepmap trapping column (100μm × 2 cm, 5 μm C18) (Thermo Scientific) analysed with Orbitrap Fusion Tribrid mass spectrometer (Thermo-Fisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... Slides were washed in 3 baths of PBS for 5 min each and mounted in Prolong Gold (Invitrogen Cat. #P36934) with a glass coverslip applied over the tissue sections ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were then washed for 3×5 minutes in PBT and mounted on a slide in a drop (∼40 µL) of SlowFade Diamond antifade (Invitrogen), covered in a 22×50 mm #1.5 coverslip sealed with nail polish ...
-
bioRxiv - Neuroscience 2023Quote: ... Coverslips were then washed 3 x for 5 min with 1x PBS before mounting onto glass slides using ProLong Diamond Antifade mountant (Invitrogen) and left to dry for 24 hr at 4°C before imaging ...
-
bioRxiv - Microbiology 2023Quote: ... was used for induction of gene expression and X-gal (X-Gal 5-Bromo-4-chloro-3-indolyl-b-D-galactopyranoside; Thermofisher) TSA plates were used for bacterial assessment ...
-
bioRxiv - Biochemistry 2023Quote: Labeled RNA oligonucleotide ‘20.25’ was annealed to non-labeled complementary RNA oligonucleotide ‘19.1’ (5’-CGU ACG CGG AAU ACU UCG A-3’, Dharmacon, Thermo Scientific) in 30 mM HEPES KOH pH 7,5 ...
-
bioRxiv - Developmental Biology 2023Quote: ... R 5’-atggatccTCATAGAGCTGAAGCCACCAG-3’) were generated by PCR amplification from 24 hpf whole embryo cDNA and cloned to pCRII-TOPO (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... or 5’-TCAAGGTCCCTGATAATTATGGCGA-3’) or scrambled siRNA (non-targeting control) using 6 μL Lipofectamine™ RNAiMAX (Invitrogen™ - Cat.# 13778075). After 24 h ...
-
bioRxiv - Genetics 2023Quote: Adult females were collected and fed for 3-5 days before ovaries were dissected and fixed in 5.14% formaldehyde (Pierce, ThermoFisher Scientific) in phosphate buffered saline (PBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... The rRNA-depleted small RNA samples were subsequently subjected to FastAP/PNK treatment to remove RNA 5’ and 3’ phosphates by incubating samples with 2.5 μl 10x FastAP Buffer (Thermo Fisher), 0.5 μl RNaseOUT (Thermo Fisher) ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was extracted in quadruplicate from male L3 larvae and 3-5 day old adults of the indicated genotypes and experimental groups using standard Trizol (ThermoFisher) extraction ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5% CO2 in a humidified incubator and were passaged every 3-4 days using 0.05% Trypsin-EDTA (ThermoFisher Scientific, 25300). Stable U2OS-derived cell lines ...
-
bioRxiv - Neuroscience 2023Quote: ... BDNF_R: 5’-GCACTTGGTCTCGTAGAAGTA-3’) designed with the web-based software Primer3 and Syber Green PCR Master mix (Applied Biosystems, US). While ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were cultured for 3 days under cold-shock conditions (32 °C/5% CO2) and in the presence of RevitaCell (ThermoFisher) and HDR enhancer (1 µM Alt-R HDR Enhancer v2 ...
-
bioRxiv - Microbiology 2023Quote: ... /AgeI-Reverse (5’-AAGTTTAAGCACGTACCGGTACGC-3’) containing the desired mutation were used to amplify two PCR products using AccuPrime Taq (Invitrogen). The amplicons were digested with either XmaI or AgeI restriction enzymes (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Clones 3 and 5 were transduced with Lenti-rtTA-P2A-Blast viruses and selected in 10 ug/mL Blasticidin (Invitrogen) for 7 days ...
-
bioRxiv - Neuroscience 2023Quote: ... pME-Dmist was recombined with 5’ (p5E-CMV/SP6) and 3’ (p3E-GFPpA) entry clones and destination vector (pDestTol2pA2) using Gateway Technology (Invitrogen LR Clonase II Plus enzyme Cat No ...
-
bioRxiv - Cell Biology 2023Quote: ... RPE-1 cells or MiniBAR-GFP stable cell lines were transfected with 25 nM of siRNAs targeting either luciferase or human Mini-BAR (5’-CUGCAAAUUUUACGGAUCA-3’) using Lipo-fectamine RNAiMAX (Invitrogen), following the manufac-turer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... Cell proliferation was assessed at different time points (3, 5, 7 and 9 days) using AlamarBlue Cell Viability Reagent (Invitrogen) per manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... Next, the slides were washed with PBS (3 times, 5 min each time) and blocked with blocking buffer (Thermo Scientific) for 30 min at 37°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... The supernatant was clarified and resuspended in PBS (3 mM EDTA) with 5 μg/mL Hoechst (33342 Thermo Fisher Scientific) and incubate 30 min at 37 °C ...
-
bioRxiv - Immunology 2023Quote: ... and probe 5’-FAM-TCCAGCCTCCATAGCCGGGAAGG-TAMRA-3’ were used in a 25μL reaction with Supermix Platinum™ Quantitative PCR SuperMix-UDG (Invitrogen). The reaction was performed in a 96-well format for real time quantification on Applied Biosystems 7900HT Fast Real-Time PCR System ...
-
bioRxiv - Systems Biology 2023Quote: ... labeled with secondary antibodies (2 hrs at RT) and washed again in PBS (3 x 5 min at RT) before being mounted in Prolong Gold (Invitrogen by Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2023Quote: ... For the construction of the RNH2A KO clones, RNASEH2A (Chr19, exon 2) gRNA (5’-TAACAGATGGCGTAGACCAT-3’) was cloned into GeneArtTM CRISPR Nuclease Vector with OFP reporter (Invitrogen) following manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2023Quote: ... Coverslips were washed with PBS 3 times for 5 minutes and Mili-Q water once before being mounted on slides by Profade-Antifade (P36935, Invitrogen) overnight in dark ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were washed 3 times for 5 minutes with PBS and then incubated with secondary antibodies (Alexa fluorophores 488 and 555, Invitrogen) for 1 hour in dark at room temperature ...
-
bioRxiv - Cancer Biology 2023Quote: ... siLuc (5′-CGUACGCGGAAUACUUCGAUUdTdT-3′) and siARP3 (SMARTpool siRNA L-012077-00-0010 (Dharmacon)) were transfected using RNAiMax (Thermo Fisher Scientific) according to manufacturer’s instruction.
-
bioRxiv - Molecular Biology 2023Quote: ... Takara)-coated plates at an MOI of 5 and the transduced population was enriched by puromycin (3 µg/mL; Gibco, China) selection for 5 days ...
-
bioRxiv - Developmental Biology 2023Quote: ... An internal standard was prepared from the isotope-labeled standards in 3% acetonitrile with 0.1% formic acid with 5 fmol/µL of Peptide Retention Time Calibration (PRTC) mixture (ThermoFisher Scientific) and 10 µg/mL E ...
-
bioRxiv - Developmental Biology 2023Quote: Adult females were collected and fed for 3-5 days before ovaries were dissected and fixed in 5.14% formaldehyde (Pierce, ThermoFisher Scientific) in phosphate buffered saline (PBS ...
-
bioRxiv - Biophysics 2024Quote: ... Individual reactions were heated to 65 °C for 5 min and transferred to ice for 3 min to facilitate annealing in SuperScript III reaction buffer (Invitrogen). After annealing ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 x 5 min) on a rocking platform and stained with 4′,6-diamidino-2- phenylindole dihydrochloride (DAPI) (Life Technologies) staining (2 μM ...
-
bioRxiv - Cell Biology 2023Quote: Sac2 knockdown was performed with siRNA targeting mouse gene sequence Inpp5f: 5’-GGAAUGCGGUAUAAACGAATT-3’ and was from Ambion (Life Technologies). OSBP knockdown was performed using ON-TARGET plus SMART pool Mouse OSBP siRNA from Dharmacon ...
-
bioRxiv - Neuroscience 2023Quote: ... washed in PBS (3 x 5 min) mounted on glass slides (SuperFrost Plus Microscope Slides, ThermoFisher Scientific, Waltham, MA, USA) and left to air-dry overnight ...
-
bioRxiv - Zoology 2023Quote: ... the sections were again washed with TBS (3 times; 5 min each) and mounted in Fluromount-G mounting media with DAPI (004959-52, Invitrogen). The dried slides were visualized using Leica DM4000B fluorescence microscope equipped with Leica DFC310 FX camera ...
-
bioRxiv - Developmental Biology 2023Quote: ... was synthesized on templates that contain the T7 promoter sequence (5’-TAATACGACTCACTATAGGGTACT-3’) at each end using a MEGAscript T7 kit (Ambion); templates were amplified from 0–4 h embryonic cDNA using specific primers (5’-AGCAGATGACGACGACAACA-3 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human lung fibroblast MRC5 and its SV40-transformed derivatives were cultured in a 5% CO2 and 3% O2-regulated incubator in MEM medium without Phenol Red (Gibco), completed with 10% FBS ...
-
Mechanisms of transcriptional regulation in Anopheles gambiae revealed by allele specific expressionbioRxiv - Genetics 2023Quote: RNA was extracted from pools of 10 female F1 progeny from each of the six crosses 3-5 days after eclosion using RNAqueous4PCR total RNA isolation kit (Invitrogen). RNA quality and quantity was checked to be adequate for library preparation using the Agilent Bioanalyser profile and Qubit® 2.0 Fluorometer ...
-
bioRxiv - Microbiology 2024Quote: ... 20% PE: 5% PS) were prepared as described in (49) with the addition of DiOC18(3) (3,3’-Dioctadecyloxacarbocyanine Perchlorate) (Invitrogen, D275) for fluorescence ...
-
bioRxiv - Neuroscience 2024Quote: ... Samples were rinsed 3 x 5 minutes with 1X PBS before mounting with Fluoromount G (Fisher Scientific; 50-259-73).
-
bioRxiv - Neuroscience 2023Quote: ... Sections were then washed 3× for 5 min each in PB and mounted with Prolong Gold (Thermo Fisher cat#P36930) and Deckglaser cover glass (Fisher Scientific cat#NC1776158) ...
-
bioRxiv - Bioengineering 2023Quote: ... The fixed cells were then washed with 0.1% Triton X-100 in PBS solution for 3 times with 5 min each and incubated with Goat anti-rabbit 488 nm (Thermofisher Scientific Cat# A-11008 ...
-
bioRxiv - Biochemistry 2024Quote: ... Samples were subsequently washed 3 x 5 mins with PBS and incubated in fluorescently conjugated secondary antibodies (goat anti-mouse Alexa Fluor 488, ThermoFisher #A11001 ...
-
bioRxiv - Bioengineering 2024Quote: ... PCR primers (F primer 5’ agatcagatctttgtcgatcctacca 3’ and R primer 5’tcatctcccggggttgtggc 3’) were used to amplify the entire first cistron and IRES using Accuprime Pfx (Invitrogen) for 30 cycles ...
-
bioRxiv - Cell Biology 2024Quote: ... On the day of electroporation organoids were dissociated into small clumps of 3-5 cells using mechanical pipetting and TrypLE incubation and resuspended in Opti-MEM Reduced Serum Medium (Gibco). 5 μg of the cloned REG1A sgRNA-plasmid ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were grown in 24 -well plates to ∼60% confluency and transfected with small interfering RNA specific to TRPM2 (TRPM2-siRNA, 5′-GAAAGAAUGCGUGUAUUUUGUAA-3′, custom-made by Dharmacon) or scrambled control siRNA (Scr-siRNA: 4390846, Ambion) in Opti-MEMTM using 25 nM siRNA and 1 ul of Lipofectamine® RNAiMAX28 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The grids were blotted for 3-5 s at 15-22 °C and 100% humidity in a Vitrobot Mark IV (ThermoFisher Scientific Inc. ...
-
bioRxiv - Cancer Biology 2024Quote: ... The cells were used at 80% to 90% confluency for all the experiments with cell viability ranging from 95 to 98% (Countess II FL, Invitrogen, Thermo Fisher Scientific).
-
bioRxiv - Cell Biology 2019Quote: ... Caspase-3/7 activation in live cells was monitored using CellEvent Caspase-3/7 Green Detection Reagent (Thermo Fisher Scientific, C10423, 1:1000) in IncuCyte Live Cell Analysis System ...