Labshake search
Citations for Thermo Fisher :
801 - 850 of 10000+ citations for 5 Isobutylcyclohexane 1 3 dione 98% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... a DNA fragment comprising the entire coding region of kpfR plus approximately 550 pb of 3’ and 5’ flanking regions (Table S4 in the supplemental material) was inserted on pCR2.1-TOPO vector (Invitrogen) previously cloned with erythromycin-resistance gene ...
-
bioRxiv - Cell Biology 2021Quote: ... and lifted for 3 min at 37°C using 5 mL of TrypLE Express (Invitrogen, Gibco, Cat no. #1260501). The appropriate number of cells were then spun down at 90 x g for 10 min at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... and lifted for 3 min at 37°C using 5 mL of TrypLE Express (Invitrogen, Gibco, Cat no. #1260501). The appropriate number of cells were then spun down at 90 x g for 10 min at room temperature ...
-
bioRxiv - Neuroscience 2022Quote: ... washed 3 times with PBS 5 min each and mounted on glass slides using Prolong Diamond antifade reagent (Invitrogen). We prepared antibodies in PBS containing 3% BSA ...
-
Molecular architecture determines brain delivery of a transferrin-receptor targeted lysosomal enzymebioRxiv - Neuroscience 2021Quote: ... Sections were then rinsed in 1xPBS/0.05% Tween for 3 rounds of 5 minutes and incubated in DAPI (Invitrogen Molecular Probes D1306 ...
-
bioRxiv - Neuroscience 2021Quote: ... The culture medium was changed every 2 to 3 days and the cells were split every 5 to 7 days using 0.25% Trypsin-EDTA (Gibco), up to 20 times ...
-
bioRxiv - Cancer Biology 2022Quote: ... Red blood cells were removed by treatment with 3-5 mL of ACK lysis buffer (Gibco, Cat. No. A1049201) and a subsequent washing step in RPMI 1640 with 10% FBS ...
-
bioRxiv - Bioengineering 2019Quote: ... C12 (4,4-Difluoro-5-Methyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid;D3823, Thermo Fisher Scientific), was added to the culture medium for a duration of 60 min and pumped through the media systems at 80 µl/h via positive pressure provided by a syringe pump ...
-
bioRxiv - Cell Biology 2020Quote: ... These duplex reactions were run in triplicate (3 wells) on a QuantStudio 5 Real-Time PCR System (Thermo Fisher). One of two duplex assay pairings were used for each experiment ...
-
bioRxiv - Pathology 2020Quote: ... reverse primer 5’-cgaactCCG AGT TTA TAC TGC CCA GTT CG-3’ with FAM-labeled LUX (Cat. no19450335, Invitrogen). The mouse Vascular Endothelial Growth Factor assay ...
-
bioRxiv - Immunology 2020Quote: ... and reverse primer ENVN (5’ - TGCCAATCAGGGAAAAAGCCTTGTGTG - 3’. The envelope amplicons were purified, and ligated into pcDNA3.1D/V5-His-TOPO vector (Invitrogen). Chimeric envelope pseudoviruses were generated by swapping the V1V2 ...
-
bioRxiv - Genetics 2020Quote: ... Samples (5 μL each) were loaded into wells of a NuPAGE Tris-acetate 3 – 8% polyacrylamide gel (ThermoFisher Scientific) and electrophoresed for 60 min at 15 volts/cm ...
-
Molecular architecture determines brain delivery of a transferrin-receptor targeted lysosomal enzymebioRxiv - Neuroscience 2021Quote: ... Sections were rinsed in 1xPBS/0.05% Tween for 3 rounds of 5 minutes followed by incubation in secondary antibody (Invitrogen: Goat anti-rat Alexa Fluor 555 ...
-
bioRxiv - Cancer Biology 2021Quote: ... LDHC expression was quantified by specific 5′FAM-3′MGB Taqman gene expression primer/probe sets (Hs00255650_m1, Applied Biosystems). MAP1B expression was quantified using primers for SYBR-based qPCR (F ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Il36A_rev (5′-CAGTTCTTGGGTCAGAATGAGTG-3′) and subsequent cloning into pJET1.2/blunt vector as described by the manufacturer (ThermoFisher Scientific). The DNA fragment encoding mouse C/EBPβ residues 221–296 (bZIP domain ...
-
bioRxiv - Genomics 2021Quote: ... 0.5μM oligo-dT (IDT; 100uM 5′-biotin-ACGAGCATCAGCAGCATACGA-T30VN-3′) and 0.5mM dNTPs/each (Thermo Fisher; 25 mM each) and snap frozen at −80 °C ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The full structure of the NUKU2 transcript was determined with 5’ and 3’ RACE using the GeneRacer kit (Invitrogen), and testicle total RNA (Ambion ...
-
bioRxiv - Immunology 2022Quote: ... PBMCs were cultured at 37°C with 5% CO2 for 3 days in RPMI-1640 medium (Thermo Fisher Scientific) supplemented 10% FCS (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: Fresh tissue samples were washed 2–3 times in PBS and incubated in 5 U/ml dispase (ThermoFisher Scientific) supplemented with antibiotics (penicillin 50U/I and streptomycin 50 mg/ml ...
-
bioRxiv - Cancer Biology 2022Quote: ... for 15 minutes at room temperature and then washed 3 times for 5 minutes each with pH 7.4 Phosphate Buffered Saline (PBS) (Gibco). Cells were then simultaneously permeabilized and blocked with a solution of 0.25% Surfact-Amps X-100 (Thermo Scientific ...
-
bioRxiv - Biochemistry 2022Quote: ... 4,4-difluoro-5-(2-thienyl)-4-bora-3a,4a-diaza-s-indacene-3-dodecanoic acid (BODIPY-C12, Invitrogen D3835), was dissolved in 100% ethanol and conjugated to 10% bovine serum albumin ...
-
bioRxiv - Plant Biology 2022Quote: ... pH 5.5 and 100 μM 3′,5′-dimethoxy-4′-hydroxyacetophenone (acetosyringone) (115540050; Acros Organics, dissolved in dimethyl sulfoxide (DMSO) (D8418 ...
-
bioRxiv - Neuroscience 2022Quote: ... Slides were rinsed 3 x 5 min and cell nuclei were labeled by DNA staining using Hoechst (Life Technologies) for 30 min at RT ...
-
bioRxiv - Bioengineering 2022Quote: ... organoids were washed 3 times for 5 minutes each using PBS and mounted on glass microscope slides (Fisher Scientific). 90 μm Polybead Microspheres (Polyscience ...
-
bioRxiv - Cancer Biology 2023Quote: ... the sample was washed 3 x 5 min with PBS and mounted in Fluoromount-G (ThermoFisher, 00-4958-02). 15 samples per genotype were prepared and photographed using a tile scan at a confocal microscope Zeiss LSM780 (Zeiss ...
-
bioRxiv - Cell Biology 2023Quote: ... boiled at 95°C for 5 min and loaded into a NuPAGE 3-8% Tris-Acetate Gel (Thermo Scientific) along with HiMark™ Pre-stained Protein Standard (Thermo Scientific LC5699) ...
-
bioRxiv - Immunology 2023Quote: ... Slides were washed extensively (3 x 5 mins) in TBS-tween20 and incubated in appropriately labeled secondary antibodies (Invitrogen) for 1 h at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... coverslips were washed once with 0.1M MOPS buffer (pH 3) and stained with 50 μg / ml 5,(6)-Carboxyfluorescein Diacetate (CFDA) (Invitrogen) in MOPS buffer for 1 h at 37°C in the dark ...
-
bioRxiv - Cell Biology 2023Quote: HEK293 (ATCC CRL-1573) and HEK239A ΔGRK2/3/5/646 were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco 1196511) supplemented with 10% FBS (Hyclone SH30910.03) ...
-
bioRxiv - Neuroscience 2023Quote: ... Zebrafish embryos were injured at 3 dpf and placed in 5 ug/mL acridine orange (ThermoFisher, Cat. No. A1301) diluted in egg water for 20 minutes ...
-
bioRxiv - Genomics 2023Quote: ... in condΔEXP168 were maintained in 3% hematocrit in human O+ blood in RPMI 1640 supplemented with 5% Albumax-II and 50µg/ml hypoxanthine (Gibco), 25mM HEPES (Sigma ...
-
bioRxiv - Bioengineering 2023Quote: ... 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium (WST-8) was purchased from ThermoFisher Scientific.
-
bioRxiv - Molecular Biology 2023Quote: The cDNAs encoding MpRBOHB and its variants with 3 × FLAG tag at their 5’-end were cloned into the pcDNA3.1(-) vector (Invitrogen) for the quantitative measurement of ROS in HEK293T cells.
-
bioRxiv - Microbiology 2024Quote: ... falciparum (3D7, Dd2, and HB3) parasites were cultured in 3-5% human O+ RBCs in RPMI-1640 (Gibco, 110875093) complete medium containing 0.5% Albumax-II (Invitrogen) ...
-
bioRxiv - Cell Biology 2024Quote: ... 0,5µM Smartseq3 OligodT30VN (IDT; 5’-Biotin-ACGAGCATCAGCAGCATACGAT30VN-3’) adjusted to RT volume and 0,5mM dNTPs/each (Thermo Fisher, #R0181). After cell sorting lysis plates were centrifuged before storage at -80°C ...
-
bioRxiv - Bioengineering 2022Quote: ... 5×5 minute PBST washes were performed followed by staining with Hoechst (1:2000; Thermo Fisher H3570) for 10 minutes at room temperature ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and mixed with 12 μl of 5-CF AM solution (Thermo Fisher Scienfic, 5 mg ml-1). The cells were incubated in dim light at 30 °C for 30 min before harvesting and washing 3 times in fresh medium ...
-
bioRxiv - Cell Biology 2019Quote: ... dissolved in solvent A [0.1% (v/v) FA in water/acetonitrile (ACN) (98:2, v/v)] and quantified by absorbance at 280 nm (NanoDrop, Thermo Fisher Scientific). Samples were analyzed by LC-MS/MS as described in Text S1.
-
bioRxiv - Cancer Biology 2024Quote: ... The cells were used at 80% to 90% confluency for all the experiments with cell viability ranging from 95 to 98% (Countess II FL, Invitrogen, Thermo Fisher Scientific).
-
bioRxiv - Biophysics 2021Quote: ... at a ratio of 1:1.5:1.75:2 (FAM155A-3×FLAG:NALCN-1077-3×HA-GFP:UNC79-3×FLAG:UNC80-3×FLAG) using Lipofectamine 3000 (Thermo Fisher Scientific) and incubated for 40-48 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... rabbit anti-centrin-3 (1:1000; PA5-35865; Thermo Scientific, Rockford, USA), rabbit anti-acetylated α-tubulin (1:800 ...
-
bioRxiv - Cell Biology 2020Quote: ... 1% [w/w] P/S [Gibco] and 1 % [w/w] Glutamax [Gibco]) supplemented with 1 μM TO-PRO®-3 (Thermo Fisher Scientific). After 16 h ...
-
bioRxiv - Immunology 2021Quote: ... 3 μl of a 1:400,000 dilution of ERCC synthetic mRNAs (ThermoFisher) were added and total RNA was isolated using a Quick-RNA MicroPrep Kit (Zymo Research ...
-
bioRxiv - Neuroscience 2022Quote: ... and nuclear dye (TO-PRO-3 Iodide, 1:400, Thermo Fisher T3605) were added to the blocking solution ...
-
bioRxiv - Neuroscience 2022Quote: ... and a 1:400 dilution of TO-PRO-3 (Thermo Fisher T3605) for 24 hr at 4°C in the dark ...
-
bioRxiv - Microbiology 2019Quote: ... and 2 μl of 1 μM ToPro 3 (Molecular Probes T-3605), a nucleic acid dye that only permeates cell membranes of dead cells ...
-
bioRxiv - Developmental Biology 2021Quote: ... and rabbit anti-activated Caspase-3 (Fisher Scientific/BD, BDB559565, 1:500). Antibody used for fluorescent in situ hybridization was mouse anti-Dig (Jackson ImmunoResearch 200-002-156 ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 nl solution of 3 μM FM 4-64 (Molecular Probes, Invitrogen) dissolved in DMSO was injected in the otic cavity of 96 hpf zebrafish embryos mounted laterally in low gelling agarose (Sigma) ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 nl solution of 3 μM FM 4-64 (Molecular Probes, Invitrogen) dissolved in DMSO was injected in the otic cavity of 96 hpf zebrafish embryos mounted laterally in low gelling agarose (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: ... to a DNA:lipofectamine ratio of 1:3 and 100μl Opti-MEM (Gibco). Cells were collected 24 hours post-transfection ...