Labshake search
Citations for Thermo Fisher :
901 - 950 of 10000+ citations for 5 Isobutylcyclohexane 1 3 dione 98% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... supplemented with 5 g L−1 yeast extract (ThermoFisher Scientific) (Sorg and Dineen 2009) ...
-
bioRxiv - Cell Biology 2022Quote: ... and fetal bovine serum (1:5 Thermo Fisher Scientific A3160801)) and cells were spun down for 6 min at 650 rcf ...
-
bioRxiv - Cancer Biology 2022Quote: ... and HEPES (1 M, 5 ml, Gibco, cat no. 15630049) were added to a full bottle of advanced DMEM/F12 (500 ml ...
-
bioRxiv - Cell Biology 2020Quote: ... 5% fetal bovine serum (FBS) and 1 % penicillin/streptomycin (Gibco, Life Technologies,
-
bioRxiv - Immunology 2021Quote: ... containing 1 µl Glycogen (5 µg/µl, Thermo Fisher Scientific). 0.8 µg total RNA was used for reverse transcription and 0.5 µl of cDNA was used for quantitative real time polymerase chain reaction (qRT-PCR) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5) Opal 690/anti-CD34 (1:100, QBEND/10, Invitrogen), 6 ...
-
bioRxiv - Cell Biology 2022Quote: ... 5□ng□ml−1 β-FGF (PHG0026, Thermo Fisher Scientific) and 1% P/S.
-
bioRxiv - Cell Biology 2022Quote: ... 0.5 ml of 5 μM Rapamycin (Fisher Scientific BP2963-1) + 150 nM GSK-A1 (Sigma SML2453 ...
-
bioRxiv - Microbiology 2023Quote: ... supplemented with 5% FBS (Bodinco) and 1% Pen/Strep (Invitrogen) (Kortekaas et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... 1% GlutaMax and 5 g/mL gentamycin (all from Gibco) at 37 °C in humidified atmosphere (95% air ...
-
bioRxiv - Cell Biology 2023Quote: ... and goat anti-rabbit Cyanine 5 (Invitrogen, A10523, 1:200) were applied for 2 hours at RT in the dark ...
-
bioRxiv - Systems Biology 2023Quote: ... 5) Opal 690/anti-CD34 (1:100, QBEND/10, Invitrogen), 6 ...
-
bioRxiv - Physiology 2024Quote: ... and 5 µL of 1-µm fluorescent beads (Invitrogen, #F13080) were intravenously injected prior to imaging ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.5 ml of 5 μM Rapamycin (Fisher Scientific BP2963-1) + 150 nM GSK-A1 (Sigma SML2453 ...
-
bioRxiv - Neuroscience 2024Quote: ... serotonin receptor 2C (5-HTR2C; Invitrogen, Waltham, MA; 1:1000). Membranes were washed three times in 0.1% Tween-20 in 1X TBS (TBST ...
-
bioRxiv - Cancer Biology 2024Quote: ... rabbit anti-SST (Thermo Fisher, PA-5-85759, 1:250), mouse anti-NeuN (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit IgG anti-claudin-5 (Invitrogen, #34-1600, 1:1000), and rabbit IgG anti-NLRP3 (Cell Signaling Technologies ...
-
bioRxiv - Genomics 2024Quote: ... 1 μl of 5 mg/mL Glycogen was added (Invitrogen) per sample ...
-
bioRxiv - Immunology 2022Quote: ... The 40 mg/ml 4-HT stock solution was diluted 1:1 in Kolliphor EL (MilliporeSigma) 59.Before injection the solution was further diluted 1:3 in PBS (Gibco) and warmed to 37°C ...
-
bioRxiv - Paleontology 2020Quote: ... for 3 min at a flow rate of 10 μl.min−1 on an Acclaim PepMap100 C18 pre-column (5 μm, 300 μm i.d. × 5 mm) from ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... The following siRNAs were used: ErbB3#1 siRNA (5’CAAUACCAGACACUGUACAAGCUCU53’) and ErbB3#2 siRNA (5’UCGUCAUGUUGAACUAUAA3’) from Invitrogen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and incubated 1 hour with 5 μg/mL Hoechst 34580 (stock 5 mg/mL in H2O) (Thermo Fisher) and anti-mouse Alexa 647 in PBS+.
-
bioRxiv - Paleontology 2023Quote: ... for 3 min at a flow rate of 10 μl.min-1 on an Acclaim PepMap100 C18 pre-column (5 μm, 300 μm i.d. × 5 mm) from ThermoFisher Scientific ...
-
bioRxiv - Developmental Biology 2021Quote: ... Cells were passaged 1:10 every 2–3 days with 1× trypsin-EDTA 0.25% (Gibco 25200-056).
-
bioRxiv - Microbiology 2019Quote: ... 1/10 volume of 3 M Sodium Acetate (pH 5.2) and 1 μl of GlycoBlue (Life Technologies). The precipitate was pelleted by centrifugation (30 min ...
-
bioRxiv - Microbiology 2020Quote: ... 1/10 volume of 3 M Sodium Acetate (pH 5.2) and 1 μl of GlycoBlue (Life Technologies). The precipitate was pelleted by centrifugation (30 min ...
-
bioRxiv - Genetics 2023Quote: ... Induction 3 Medium (StemPro-34 complete media, 20 mM HEPES, 1% GlutaMAX, 1% Penicillin-Streptomycin (Life Technologies); 213 μg/mL 2-phosphate Ascorbic Acid (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue sections were blocked with 3% bovine serum albumin (BSA, Fisher Bioreagents) and 5% normal goat serum (NGS, Gibco #PCN5000) in PBS for 1 hour at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... A Lsm12-KO cell line of HEK293 cells was generated with Synthego’s chemically modified sgRNA 5’-CCAGAAUGUCCCUCUUCCAG-3’ and GeneArt Platinium Cas9 nuclease (ThermoFisher Scientific) that were transfected together into cells using Lipofectamine CRISPRMAX Cas9 transfection reagent (ThermoFisher Scientific).
-
bioRxiv - Genetics 2021Quote: The SNP STARRseq library (100ug plasmid DNA/replica) was transfected into LNCaP cells (5 × 107 cells/replica; 3 biological replicas) using the Neon Transfection System (Invitrogen). Cells were grown in RPMI 1640 medium supplemented with 10% FBS and collected 48hrs post-electroporation ...
-
bioRxiv - Molecular Biology 2021Quote: ... Individual reactions were heated to 65 °C for 5 min and transferred to ice for 3 min to facilitate annealing in SuperScript III reaction buffer (Invitrogen). After annealing ...
-
bioRxiv - Developmental Biology 2021Quote: ... Alkaline phosphatase staining was performed using the one-step nitro-blue tetrazolium (NBT) and 5-bromo-4-chloro-3’-indolyphosphate p-toluidine salt (BCIP) solution (Thermofisher).
-
bioRxiv - Neuroscience 2022Quote: ... Recordings were made with patch pipettes (3-5 MΩ) containing aCSF and 10 µM alexa-594 (Thermofisher, Waltham, MA, USA) and CSFcNs were targeted under visual guidance using their fluorescence ...
-
bioRxiv - Neuroscience 2021Quote: ... We washed the cells 3 times for 5 minutes each with 1X PBS and mounted with ProLong Gold Antifade Mountant with DAPI media (Invitrogen) to preserve the cells for imaging ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were rinsed in Milli-Q water for 3 × 5 minutes and cover slipped with ProLong Gold Antifade (Invitrogen, P36930).
-
bioRxiv - Neuroscience 2021Quote: ... Tet-on 3’ UTR HP and 5’ UTR HP DG NSCs were brought in suspension by incubating with 0.25% trypsin (Gibco #15090) in Versene (Gibco #15040 ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was isolated from Hela cells (n = 3) subjected to EBSS-induced autophagy and treatment with 5 μM UNC0638 for 12 hours using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... Soluble material was incubated with 3-5 μg of antibody bound to 50 μl protein A or protein G Dynabeads (Invitrogen) and incubated overnight at 4 °C ...
-
bioRxiv - Cell Biology 2019Quote: ... The resulting PCR product was cloned between 5’ KpnI and 3’ EcoRI sites of the pMT/V5-His vector (Invitrogen). In-frame Tag-RFP-T gene was then introduced at the 3’ end of γ-tubulin gene between 5’ EcoRI and 3’ NotI sites ...
-
bioRxiv - Cell Biology 2019Quote: ... The resulting PCR product was then inserted into the 5’ SpeI and 3’ EcoRI sites of the pMT/V5 His-B vector (Invitrogen) containing in-frame mTurquoise2 gene at the 5’ end ...
-
bioRxiv - Neuroscience 2019Quote: ... post-axotomy cultures were loaded with lipophilic dye N-(3-trimethylammoniumpropyl) -4-(6-(4-(diethylamino) phenyl) hexatrienyl)pyridinium dibromide (FM 5–95; Invitrogen) using KCl mediated depolarization as described previously (Taylor et al ...
-
bioRxiv - Microbiology 2019Quote: ... was carried out by taking 500 µl of the culture from respective time points into Eppendorf tubes and incubated them with 5 µM 3’-(p-hydroxyphenyl fluorescein (HPF; Invitrogen) (0.5 µl of HPF from 5 mM stock ...
-
bioRxiv - Molecular Biology 2019Quote: ... 3-9) or 5 µl (IP: Figure 2A-2C and input: Figure 2-9) RNAse A/T1 (Thermo Scientific #EN0551) and incubation the beads at 37°C for 30 minutes ...
-
bioRxiv - Molecular Biology 2019Quote: Three specific 5’ RACE primers and two 3’ RACE primers were designed according to the Race kit instructions (Invitrogen & Clontech) (Table S1) ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were washed 3 times with PBS (5 min, RT) and mounted using ProLong® Gold antifade mountant (ThermoFisher, P36930). STED microscopy was performed using a 100× objective on the STEDYCON 2-colour STED imaging system (Abberior Instruments) ...
-
bioRxiv - Neuroscience 2019Quote: ... A sequence including the zinc finger binding sequence (5’-GTCATCCTCATC-3’) (Gross et al., 2013; Perez et al., 2008) upstream of the hsyn1 promoter was synthesized (ThermoFisher) and inserted using the MluI and EcoRI restriction sites to generate pAAV-ZFBS-syn-PSD95.FingR-dNES-CaMPARI2_F391W_L398V-CCR5TC ...
-
bioRxiv - Cancer Biology 2019Quote: ... ssDNA (M13 primer ssDNA-M13 primer 5’-TGT-AAA-ACG-ACG-GCC-AGT-3’, paraformaldehyde (PFA) were purchased from ThermoFisher. PicoGreen variants were synthesized in house at ThermoFisher ...
-
bioRxiv - Microbiology 2021Quote: Approximately 200 ng of extracted vRNA was reverse transcribed using a universal 3′ primer (5′-AGGGCTCTTCGGCCAGCRAAAGCAGG) and Superscript III reverse transcriptase (RT) (Invitrogen). The RT product was diluted approximately 10,000-fold and used as a template for quantitative PCR (qPCR) ...
-
bioRxiv - Bioengineering 2020Quote: ... Separation was performed on an Aquasil C18 column (250 cm x 3 mm, 5 µm particle size; Thermo Fisher Scinetific) at a flow rate of 1 ml/min ...
-
bioRxiv - Immunology 2020Quote: ... was added using the primers 5’ GACCGTCTCGAGAAAAGAAAAGTCTTTGGACGATGTGAGC and 3’ GTGACTGAATTCTTACTAATGGTGATGGTGGTGATGGCCGCTCAGCCGGCAGCCTCTGA TCCAC and the product was subsequently cloned into the vector pPIC9K (Invitrogen) between the Xho I and EcoR I sites by doing a three-way ligation (EcoR I ...