Labshake search
Citations for Thermo Fisher :
9951 - 10000 of 10000+ citations for TIM 3 Human HEK 293 Fc His since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2023Quote: ... We then separated protein complexes using 3-8% Tris-acetate gels (Thermo Fisher, EA0378) and native running buffer (90 mM Tris Base ...
-
bioRxiv - Biochemistry 2023Quote: Protein A/G agarose beads for immunpreciptation (Figure 3) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2023Quote: ... Membranes were fixed and stained using the PROTOCOL HEMA 3 Stain Set (Fisher Scientific) after removing all cells from the top side of the membrane ...
-
bioRxiv - Biochemistry 2022Quote: ... After cell lysis and separation in a 3-8% Tris-acetate polyacrylamide gel (Invitrogen), proteins were transferred to a nitrocellulose membrane (Cytiva) ...
-
bioRxiv - Neuroscience 2023Quote: ... Heavy isotope-labelled versions of each monitored peptide (PEPotec SRM Grade 3, ThermoFisher Scientific) were spiked in the digested CSF samples at optimal dilution to obtain for each peptide a signal similar to those of the corresponding endogenous peptides ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... blocked for 20’ with hydrogen peroxidase (3%, Alexa Fluor 594 Tyramide SuperBoost Kit, Invitrogen, Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2023Quote: ... Dextrans with the following molecular weights were used: 3 kDa (Thermo Fisher Scientific D3328), 10 kDa (Thermo Fisher Scientific D1828) ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were passaged every 3-5 days as necessary using 0.5mM EDTA (Thermo Fisher). All staining and qPCR experiments included in Figure 1 were carried out in H1 and H9 stem cells ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5’ TCTTGCGGCTTTGTTGACAC 3’) using SYBR™ Green PCR Master Mix (Applied Biosystems, Bedford, MA). The quantities measured by real-time PCR were normalized to the Rpl13 (5’GGCGGACCGATTCAATAAGGTTCTGATCATTG 3’ ...
-
bioRxiv - Microbiology 2023Quote: ... on the QuantStudio™ 3 Real-Time PCR System (Thermo Fisher Scientific, Massachusetts, USA) and analysis was performed using QuantStudio™ Design and Analysis Software v1.5.2 ...
-
bioRxiv - Microbiology 2023Quote: ... fluorescent beads (3-μm red fluorescent beads Cat R0300, Thermo Fisher Scientific, Waltham, MA) of known concentration were added to each sample ...
-
bioRxiv - Plant Biology 2023Quote: ... The RT-qPCR was performed in the QuantStudio 3 Real-Time PCR (Thermo Fisher) and used SyberGreen to monitor double-stranded DNA synthesis ...
-
bioRxiv - Genomics 2023Quote: ... and for amplification of fragments longer than > 3 kb Platinum taq HiFi polymerase (Invitrogen) was used.
-
bioRxiv - Developmental Biology 2023Quote: ... Primed mESCs were passaged every 3 days using 1 U/ml of Dispase (Gibco) as a colony detachment reagent ...
-
Analysis of spike protein variants evolved in a novel mouse model of persistent SARS-CoV-2 infectionbioRxiv - Microbiology 2023Quote: ... the supernatant was removed and 3 ml of DMEM/F12 medium (Thermo Fisher Scientific) containing 2% Oxoid agar was added ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA was analyzed using the Quant Studio 3 Real-Time PCR system (Applied Biosystems) using Power SYBR® Green RNA-to-CT™ 1-Step Kit (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2023Quote: ... 100μg of the lysate was loaded into 3%-8% precast gels (EA0378, Invitrogen™).
-
bioRxiv - Cell Biology 2023Quote: ... qPCR analysis was performed on the QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific) to detect each target gene (Table S2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... mixed with 3% w/v low melting point agarose (UltraPure, Invitrogen, Thermo Fisher Scientific) in F/2-Si medium to a final concentration of 0.3% ...
-
bioRxiv - Cancer Biology 2023Quote: ... The signals were measured in the QuantStudio 3 Real-Time PCR System (Applied Biosystems). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH ...
-
bioRxiv - Biophysics 2023Quote: ... 0.1% of the Texas Red 1,2-Dihexadecanoyl-sn-Glycero-3-Phosphoethanolamine (TR-DHPE, Invitrogen) replaced the DOPC when fluorescent reporter was used ...
-
bioRxiv - Biochemistry 2023Quote: ... and run on Native PAGE™ Novex 3–12% Bis-Tris gels (ThermoFisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... The following siRNA target sequences were used: GTPBP5 siRNA: 5’-CGGUGGACACGUCAUUCUGTT-3’ (134621, Ambion); GTPBP7 siRNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were washed 3 times in ice-cold 1X DPBS (Gibco, cat.no. 14080-048) at 500g for 5 min ...
-
bioRxiv - Cell Biology 2023Quote: ... Cell suspension densities were determined using an automated cell counter (Invitrogen Countess 3 FL) and adjusted to ∼1-2 ×106 cells/mL with chilled FACS buffer ...
-
bioRxiv - Microbiology 2023Quote: ... A Hypercarb analytical column (100 by 2.1 mm, 3 mm; Thermo Fisher Scientific, USA) and mobile phases 100 mM ammonium acetate (Buffer A ...
-
bioRxiv - Bioengineering 2023Quote: ... The cells were counted using an automated cell counter (Countess™ 3, Thermo Fisher) and all the samples were concentration-matched to 10 million cells per milliliter in HHBSS without calcium ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 3 µg psPAX2 were combined with 27 µL of lipofectamine 2000 (Thermo Fisher) in 200 µL of OPTI-MEM ...
-
bioRxiv - Molecular Biology 2023Quote: ... Polysomes were collapsed to monosomes by digestion with 3 units of RNase I (Ambion) per A260 unit for 2 hr at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... and electroporated using the Neon System (Invitrogen, Condition: 1450 V, 10 ms, 3-pulses). Electroporated fibroblasts were subsequently plated across 3 wells of a Geltrex™ (Thermo Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... Electroporated fibroblasts were subsequently plated across 3 wells of a Geltrex™ (Thermo Scientific) coated 6-well plate with daily media changes of fresh fibroblast media until day 3 ...
-
bioRxiv - Neuroscience 2023Quote: ... The nuclei were visualised by staining with TO-PRO-3 iodide (Thermo Fisher Scientific). Confocal images were recorded using LSM 780 microscopes built around an Axio Observer Z1 with Plan-Apochromat 20× (numerical aperture [NA] 0.8) ...
-
bioRxiv - Microbiology 2023Quote: ... 3 μL of sample was vitrified on grids using a Mark IV Vitrobot (ThermoFisher). 30 min prior to sample vitrification ...
-
bioRxiv - Pathology 2023Quote: ... The reactions were conducted in the QuantStudio 3 Real-Time PCR System (Thermo Scientific). The cDNA of the samples identified as Trab8a and XIR2a (the same used in the RNA-seq experiment ...
-
Essential roles of the ANKRD31-REC114 interaction in meiotic recombination and mouse spermatogenesisbioRxiv - Genetics 2023Quote: Eluted proteins were separated on 3%–8% Tris-Acetate NuPAGE precast gels (Life Technologies) at 150 V for 70 min and were transferred to polyvinylidene difluoride (PVDF ...
-
bioRxiv - Genomics 2023Quote: ... cells were washed with 1x DPBS and crosslinked with 3 mM EGS (ThermoFisher #21565) in 1x DPBS at 4 mio cells/mL for 40 min with rotation at RT ...
-
bioRxiv - Microbiology 2023Quote: ... Substrate 2,2’-Azinobis [3-ethylbenzothiazoline-6-sulfonic acid]-diammonium salt (ABTS; Thermo Fisher Scientific) was added ...
-
bioRxiv - Immunology 2023Quote: ... All samples were quantitated through the Invitrogen Countess 3 FL Automated Cell Counter (Invitrogen, Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... and results were detected in a real-time PCR machine (Applied Biosystems QuantStudio 3) for 30 min with the fluorescence signal collected every 15 s (λex ...
-
bioRxiv - Cancer Biology 2023Quote: ... Stable polyclonal populations of cells were selected using 3 μg ml-1 puromycin (Invitrogen).
-
bioRxiv - Cell Biology 2023Quote: ... MCEC were split every 2-3 days using TrypLE express enzyme (GibcoTM, Thermo Scientific) for 5min at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... transfected cells were selected with 3 μg/ml puromycin (#A11138-03, Thermo Fisher Scientific) 48 hours post transfection ...
-
bioRxiv - Biochemistry 2023Quote: ... After cell lysis and separation in a 3-8% Tris-acetate polyacrylamide gel (Invitrogen), proteins were transferred to a nitrocellulose membrane (Cytiva) ...
-
bioRxiv - Physiology 2023Quote: ... and Cy-3 conjugated anti rabbit IgG at (dilution 1:300) (A10520, Thermo Fisher) for 1 hour at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... Biotin-labeled cRNA probes were prepared using the GeneChip 3’IVT Express Kit (Affymetrix). The probes were hybridized to a custom-made microarray (Marmo2a520631F ...
-
Volumetric Compression Shifts Rho GTPase Balance and Induces Mechanobiological Cell State TransitionbioRxiv - Biophysics 2023Quote: ... even layer of 0.1N NaOH and then silanized with (3-aminopropyl)trimethoxysilane (Thermo Scientific) for 3 min ...
-
Volumetric Compression Shifts Rho GTPase Balance and Induces Mechanobiological Cell State TransitionbioRxiv - Biophysics 2023Quote: ... were coated with 1.8 mg/mL 3-hydroxytyramine hydrochloride (or dopamine-HCl, Acros Organics) in 10mM Tris-HCl buffer (pH 8.5 ...
-
bioRxiv - Cell Biology 2023Quote: ... or CellEvent™ Caspase-3/7 Green Flow Cytometry Assay Kit (Thermo Fisher Scientific) to label apoptotic cells (Caspase-3/7 activity-positive and SytoxAADvanced-negative ...
-
bioRxiv - Cell Biology 2023Quote: ... Apoptotic cells were detected with CellEvent™ Caspase-3/7 Green Detection Reagent (Invitrogen) (1:500) ...
-
bioRxiv - Plant Biology 2023Quote: ... samples were loaded onto a 3-12% Native PAGE Bis/Tris precast gel (Invitrogen) and were run using the XCell SureLock™ Mini-Cell system (Invitrogen ...