Labshake search
Citations for Thermo Fisher :
951 - 1000 of 10000+ citations for 7 Chlorothieno 2 3 c pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... at an annealing temperate of 55°C and for 40 cycles on a QuantStudio 3 RT PCR System (Applied Biosystems). Genomic copies were determined by correlation to an AdV DNA standard and normalized to DNA input and stool weight ...
-
bioRxiv - Molecular Biology 2021Quote: ... COCS were incubated for 3 days at 4°C with secondary antibodies Alexa594-conjugated goat anti-rabbit IgG (Life Technologies) or Alexa647-conjugated goat anti-rat IgG (Life Technologies ...
-
bioRxiv - Cell Biology 2019Quote: ... and 100 µg/ml CHX) and centrifuged at 35,000 rpm for 3 hours at 4° C in a TH-641 rotor (Thermo Scientific) before collecting the monosome and polysome peaks (Fig 5E) ...
-
bioRxiv - Neuroscience 2019Quote: ... worms were kept at 4°C for 3 hours in 2X SSC buffer before treatment with Prolong Diamond Antifade (ThermoFisher, cat # P36961 ...
-
bioRxiv - Genomics 2020Quote: ... Cell lysates dissolved in SDS load buffer were heated at 90°C for 3 min and separated on a Novex WedgeWell 4-12% Tris-Glycine Gel (Invitrogen). Proteins were transferred to a PVDF Transfer Membrane (Thermo Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... 1.3163 g/cm3) and ultracentrifuged for 3 hours at 180,000 × g (average) at 4°C (TH-641 rotor, Thermo Fisher, thinwall polypropylene tube with 13.2 ml capacity ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were then passaged 1:3 as clumps using 15 min 37°C incubation with 1mg/ml collagenase IV (Invitrogen) onto plates coated with 1:50 GFR-Matrigel (Corning ...
-
bioRxiv - Molecular Biology 2022Quote: ... incubated for 3 minutes at 95°C and loaded on NuPAGE 4 - 12 % Bis-Tris Mini Protein Gel (ThermoFisher Scientific). Proteins were separated by electrophoresis in NuPAGE MOPS SDS running buffer and transferred in Bjerrum Schafer-Nielsen transfer buffer (48 mM Tris ...
-
bioRxiv - Neuroscience 2022Quote: ... RRID: AB_10541045) for 3 days at 4°C followed by 2h in 1:800 anti-mouse FluoroNanogold (Life Technologies, A24920) at room temperature ...
-
bioRxiv - Biophysics 2022Quote: ... were washed three times in sterile PBS and opsonized overnight at 4°C in 3 mg/mL mouse IgG (Invitrogen). To remove excess antibody ...
-
bioRxiv - Genomics 2022Quote: ... were dissociated from a confluent tissue culture flask with 0.25% Trypsin-EDTA for 3 minutes at 37°C (Gibco, 25200056), counted on a hemocytometer ...
-
bioRxiv - Immunology 2022Quote: ... Heat inactivated serum samples (56°C for 1 hour) were serially diluted (3-fold) in minimum essential media (MEM; Gibco) supplemented with 2 mM L-glutamine (Gibco) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were boiled for 5min at 95°C before being loaded on a 3-8% NuPAGE Tris-Acetate gel (Invitrogen). Western blots were quantified using ImageJ ...
-
bioRxiv - Microbiology 2021Quote: ... total RNA extracted from reovirus-infected cells was denatured at 95°C for 3 mins and subjected to reverse transcription using SuperScriptTM III Reverse Transcriptase (Invitrogen). A primer (S4 forward ...
-
bioRxiv - Neuroscience 2020Quote: ... Protein samples were heated to 70°C and loaded on 3-8% Tris-Acetate Protein Gels (ThermoFisher Scientific, Waltham, MA) or NuPAGE 4-12% Bis-Tris Protein Gels (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... Cys469 in the C-terminal DNase domain of these ColE9 constructs was labelled with a 3-fold Alexa Fluor 488-maleimide (Invitrogen) as previously described (41) ...
-
bioRxiv - Immunology 2021Quote: ... 4 million splenocytes cells were stimulated ex vivo for 3 hours at 5% CO2 at 37°C in Minimum Essential Media (Gibco) containing 10% fetal bovine serum (FBS ...
-
bioRxiv - Neuroscience 2022Quote: ... 5’ – CCT GAA ATC GCT GAT GTG TAG TCG TCA GTC AGT GGC CAA AAC GAC TAC ACA AAT CAG CGA TTT C - 3’) obtained from Invitrogen. The miRNA plasmids were then sub-cloned into an AAV2 expression backbone downstream of a CMV promoter and of an EYFP reporter sequence ...
-
bioRxiv - Developmental Biology 2020Quote: ... for 3 to 5 min at 37°C and resuspended in differentiation medium N2B27 (Advanced DMEM F12, Neurobasal vol:vol (Life Technologies)) ...
-
bioRxiv - Biochemistry 2019Quote: ... blotted for 3 s at 100% humidity at 22°C and frozen in liquid ethane using a Vitrobot Mark IV (Thermofisher). All EM data were collected using a Titan Krios (Thermofisher ...
-
bioRxiv - Cell Biology 2021Quote: RBL-2H3 cells in a confluent 75 cm2 flask were washed and trypsinized for 8 min at 37 °C with 3 mL of 0.05% Trypsin-EDTA (Thermo Fisher). The detached cells were resuspended in 7 mL of growth medium and centrifuged to remove the medium ...
-
bioRxiv - Developmental Biology 2021Quote: ... for 3 hr at 37 °C with 10 μg/mL recombinant laminin-521 (BioLamina, LN521-05) diluted in PBS+/+ (Gibco). Single-cell suspensions were then incubated for 3 hr at 37 °C in HUESM medium supplemented with 20 ng/mL bFGF and 10 μM Rock inhibitor Y27632 ...
-
bioRxiv - Neuroscience 2021Quote: ... They were incubated with 0.05% trypsin containing 0.05% EDTA at 37 °C for 20 mins and then washed 3 times with DRG growth medium (neurobasal media from Gibco) containing 2% B27 (Invtrogen) ...
-
bioRxiv - Immunology 2021Quote: ... 4 million cells per sample were stimulated ex vivo for 3 hours at 5% CO2 at 37°C in Minimum Essential Media (Gibco) containing 10% fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2021Quote: ... 4 million isolated splenocytes or inguinal lymph node cells were stimulated ex vivo for 3 hours at 5% CO2 at 37°C in Minimum Essential Media (Gibco) containing 10% fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2021Quote: ... Expi293F™ cells were seeded to a final density of 2.5-3 × 106 viable cells/ml and grown overnight at 37 °C in Expi293™ Expression Medium (Gibco). The following day ...
-
bioRxiv - Microbiology 2022Quote: ... connected to a PepMap C-18 trap-column (0.075 x 50 mm, 3 m particle size, 100 pore size; Thermo Fisher) and an in-house-packed C18 column μ (column material ...
-
bioRxiv - Neuroscience 2022Quote: ... the cell cultures were washed 3 times with 37 °C DPBS+ and fixed using 4% w/v paraformaldehyde (PFA; Affymetrix) in PBS for 2.5 h ...
-
bioRxiv - Immunology 2022Quote: ... Heat inactivated serum samples (56°C for 30 min) were serially diluted (3-fold) in minimum essential media (MEM; Gibco) supplemented with 1x Glutamax (Gibco) ...
-
bioRxiv - Cancer Biology 2022Quote: ... minced skin was incubated at 37°C for 3 – 5 hours in 5 ml of DMEM high glucose (#41965-039; Gibco) supplemented with 10 mg ml-1 collagenase (#C9891 ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA was eluted in 100 µL of nuclease free water and precipitated at -80 °C for ≥ 3 hours with 1 µL of 15 mg/mL GlycoBlue coprecipitant (ThermoFisher), 10 µL of 3 M sodium acetate pH 5.5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5-15 μg poly(A)-selected mRNA was fragmented for 3 minutes at 70°C using alkaline hydrolysis fragmentation reagent (AM8740, Ambion). Fragmented mRNAs were purified by performing a 1.8X bead cleanup with RNAClean XP beads (A63987 ...
-
bioRxiv - Cell Biology 2023Quote: ... and the cell bodies were removed by centrifugation (1,150 g, 3 min, 4°C; Sorvall Legend XTR, Thermo Fisher Scientific). A sucrose cushion (10 ML of 25% sucrose in HMS ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were cultured for 3 days under cold-shock conditions (32 °C/5% CO2) and in the presence of RevitaCell (ThermoFisher) and HDR enhancer (1 µM Alt-R HDR Enhancer v2 ...
-
bioRxiv - Biophysics 2022Quote: ... CaVβ3-stable cells were grown in suspension at 37°C supplied with 8% CO2 in FreeStyle 293 Expression Medium (Gibco) supplemented with 2% fetal bovine serum (FBS ...
-
bioRxiv - Biochemistry 2023Quote: ... 16 mL of HMA-10 buffer was added and the preparation was put on a shaking rocker for one hour at 4 °C with 3 units/mL Rnase-free Dnase (Ambion) added ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR primers used were 5′–3′ TCTCTTTTGAAGAAGAACGCCT and GCTTAAGCTGTTCTGACCGT and PCR was carried out with annealing temperature of 62°C using Platinum Superfi polymerase (Thermofisher) for 34 cycles.
-
bioRxiv - Biophysics 2024Quote: ... Individual reactions were heated to 65 °C for 5 min and transferred to ice for 3 min to facilitate annealing in SuperScript III reaction buffer (Invitrogen). After annealing ...
-
bioRxiv - Systems Biology 2024Quote: ... Cells were seeded at the coated chamber slides with a density 200000 cells per well and the next day four hours before imaging cells were stained with 1 µg/ml Hoechst 33342 for 30 min at 37°C and washed 3 times for 10 min each with Live Cell Imaging Solution (Invitrogen). When applicable ...
-
bioRxiv - Plant Biology 2023Quote: ... These were then denatured for 3 minutes at 95°C and analyzed on an ABI 3730 instrument (Applied Biosystems Inc.) at the Veterinary Genetics Laboratory at the University of California ...
-
bioRxiv - Developmental Biology 2023Quote: ... and aliquoted to 1 µg/µL in RNAse-free water at -80 °C for storage (concentration was determined using a Qubit 3 Fluorometer, Invitrogen).
-
bioRxiv - Developmental Biology 2023Quote: ... 5‘-AAA AAA AGC ACC GAC TCG GTG CCA C-3’) and in vitro transcribe using the MAXIscript T7 kit (Invitrogen) and purified with a miRNeasy mini kit (QIAGEN ...
-
bioRxiv - Microbiology 2024Quote: ... The clarified lysate was transferred to a 15 mL column containing 3 mL Ni-NTA Agarose affinity resin equilibrated with buffer A at 4 °C (Invitrogen). The column was washed using a gradient of Buffer A containing 20 mM ...
-
bioRxiv - Molecular Biology 2024Quote: Step 3 - exonuclease treatment: reaction was cooled down to 37°C and 10 U of Exonuclease I (# EN0581, ThermoFisher Scientific) and 50 U of Exonuclease III (#M0206L ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Samples were drawn after 0.5, 1, 3, 5, 8, and 24 h incubation and centrifuged (21500 xg, 4 °C, 20 min) (Thermo Scientific SL 8R Centrifuge ...
-
bioRxiv - Cell Biology 2024Quote: ... siRNA-treated cells were washed twice with 37°C M1 and replaced with M1 containing 1 μM TO-PRO-3 iodide (ThermoFisher) or washed once with 37°C M2 containing 5 mM ethylene glycol-bis(2-aminoethylether)-N ...
-
bioRxiv - Neuroscience 2023Quote: ... Homogenates were centrifuged for 25 mins at 35,000 x g and the supernatant was adjusted to approximately 3 mg/ml protein (Nanodrop 2000 C, Thermofisher Scientific). To capture the SVs for content detection ...
-
bioRxiv - Molecular Biology 2024Quote: ... The enteroids were then pelleted at 300 x g for 3 min at 4 °C and washed once with advanced DMEM/F-12 basal media (Gibco). The enteroid pellet was resuspended in the desired volume of IntestiCult complete medium (Stemcell Technologies ...
-
bioRxiv - Molecular Biology 2023Quote: ... The grids were blotted for 3-5 s at 15-22 °C and 100% humidity in a Vitrobot Mark IV (ThermoFisher Scientific Inc. ...
-
bioRxiv - Cell Biology 2019Quote: ... on a QuantStudio 7 Flex instrument (Applied Biosystems). Relative gene expression was calculated using the ΔΔCq method and normalized to GAPDH expression ...