Labshake search
Citations for Thermo Fisher :
1101 - 1150 of 10000+ citations for 7 Chlorothieno 2 3 c pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... The following day each well was co-transfected with 1 µg of replicon-encoding plasmid and 3 µg of C-prM-E-encoding plasmid using Lipofectamine 3000 (Cat# L3000-015; ThermoFisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... To revive hiPSCs from cryopreservation cells were thawed by incubation for 2 minutes at 37°C and retrieved by centrifugation (200 x g for 3 minutes) prior to resuspension in Essential 8 (E8, (A1517001, Life Technologies) medium with 1’RevitaCell ...
-
bioRxiv - Cell Biology 2023Quote: The HPLC run was performed using a C30 reverse-phase column (Thermo Acclaim C30, 2.1 250 mm, 3 mm, operated at 40°C; Thermo Fisher Scientific) connected to a Shimadzu LC-20AD HPLC system ...
-
bioRxiv - Microbiology 2023Quote: ... the indicated amounts of protein sample were boiled at 95°C for 3 min and separated by 4–12% Bis-Tris SDS-PAGE (Thermo Scientific) either in 1x MES buffer (Thermo Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... UHPLC analysis was performed employing a C30 reverse-phase column (Thermo Acclaim C30, 2.1x 250 mm, 3 μM, operated at 55° C; Thermo Fisher Scientific) connected to a Dionex UltiMate 3000 UHPLC system and a Q-Exactive Orbitrap high resolution mass spectrometer (Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2023Quote: ... UHPLC analysis was performed on a C30 reverse-phase column (Thermo Acclaim C30, 2.1 x 250 mm, 3 μm operated at 55° C; Thermo Fisher Scientific) connected to a Dionex UltiMate 3000 HPLC system and a QExactive orbitrap MS (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... maintained at 37° C and 5% CO2 and passaged every 3-4 days using trypsin-EDTA 0.05% (Life Technologies, Paisley, UK) to detach the cells ...
-
bioRxiv - Biochemistry 2023Quote: ... A temperature ramp from 5°C to 95°C was set up at a speed of 0.02°C/s on a QuantStudio 3 Real-Time PCR system (Thermo Fisher Scientific). All measurements were performed in triplicates ...
-
bioRxiv - Immunology 2023Quote: ... mammalian expression constructs carrying C-terminal 6X-His tagged gene of interest (HpARI1-3, or ST2 ectodomain) were transfected individually into Expi293F cells (Thermo Fisher) using the Expifectamine transfection kit (Thermo Fisher) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and blotted on two sides for 3 sec at 4 °C and 100% humidity before vitrified in liquid ethane using a Vitrobot Mark IV (Thermo Fisher). The grids were subsequently transferred to a Titan Krios (G3i ...
-
bioRxiv - Genomics 2023Quote: ... treatment at 37 °C for ∼3 mins and subsequent pipette-mixing with 10 mL of DMEM (Thermo Fisher Scientific, Cat # 11965092) + 10% FBS (Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2024Quote: ... plus 1% penicillin/streptomycin in a humidified incubator at 37 °C and 5% CO2 and passaged every 3-4 days using 0.05% of Trypsin-EDTA (Thermo Fisher Scientific) to lift the cells from the culture dish ...
-
bioRxiv - Developmental Biology 2024Quote: ... Flow cytometry was used to evaluate the efficiency of differentiation to definitive endoderm at day 3 using the endoderm markers CXCR4 and c-KIT (Anti-human CXCR4 PE conjugate, Thermo Fisher, MHCXCR404,1:20 ...
-
bioRxiv - Cell Biology 2024Quote: ... BN-PAGE was performed at 4°C on Native PAGE Novex 3-12% Bis-Tris Protein gels (Thermo Fisher Scientific, BN1001) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... then incubated for 3 days (room temperature during the day and 4 °C at night) in PAT-NGS containing rabbit anti-GFP (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: The tadpole was stepwise rehydrated in 1x PBS with 0.1% Triton X-100 (PBST) and blocking was performed for 3 days at 4°C in 10% CAS-Block / 90% PBST (008120, Life Technologies). Staining was performed using Atp1a1 antibody (1:500 ...
-
bioRxiv - Bioengineering 2019Quote: DSS-treated mice received 3 cycles of 2% (weight/volume) DSS (40,000 MW, Alfa Aesar, Thermo Fisher, France) in drinking water for 5 days ...
-
bioRxiv - Cell Biology 2019Quote: ... and induced to differentiate in myotubes for 2-3 days in differentiation media (DM: IMDM (Gibco, 21980-032) + 2% of horse serum (Gibco ...
-
bioRxiv - Neuroscience 2021Quote: ... Cultured neurons were incubated with 3 μg/mL of the ratiometric calcium indicator Fura-2 AM (Life Technologies) in external recording solution for 30 min at 37°C and 5% CO2 ...
-
bioRxiv - Neuroscience 2020Quote: ... was aspirated and the fixed cells treated with 2-3 drops of ProLong Gold Antifade Mountant (Invitrogen #P36930) before imaging ...
-
bioRxiv - Plant Biology 2020Quote: ... seedlings were washed for 2-3 min in water and transferred to a chambered cover glass (Thermo Scientific), and imaged either as described above or using a Leica DM5500 wide field microscope (GFP filtercube ex ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA was reverse-transcribed by addition of 3 μl of RT mix (2 μl 5x SSIV buffer [Invitrogen] ...
-
bioRxiv - Microbiology 2020Quote: ... Myoblat and myotubes viability was determined by 3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide (MTT; Life Technologies) metabolization.
-
bioRxiv - Cancer Biology 2020Quote: ... then assayed in a standard MTT assay: 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (ThermoFisher, Waltham, MA) [39] ...
-
bioRxiv - Biochemistry 2022Quote: ... equipped with an Acclaim Pepmap C18 trap column (2 cm * 75 µm, particle size: 3 µm; Thermo Fisher) and a C18 analytical column (50 cm * 75 µm ...
-
bioRxiv - Neuroscience 2022Quote: ... the cerebral cortexes from 2-3 P3-P5 C57BL/6 mice were collected in ice cold HBSS (Invitrogen), the tissue was washed three times with HBSS and digested with 0.04% trypsin (Sigma ...
-
bioRxiv - Genetics 2021Quote: ... Gels were run at 120V for 2-3 hours in Bolt MES SDS Running Buffer (Thermo Fisher Scientific) prior to protein transfer to Amersham Protran nitrocellulose blotting membrane (GE Healthcare ...
-
bioRxiv - Neuroscience 2021Quote: ... supplemented with NeuroCult™ SM1 neuronal supplement (STEMCELL), L-glutamine (2 mM, PAA) and 3% horse serum (Invitrogen) at 37°C in 5% CO2 ...
-
bioRxiv - Zoology 2020Quote: ... 2’-(4-ethoxyphenyl)-5-(4-methyl-1-piperazinyl)-23491-52-3 (Hoechst 33342, trihydrochloride, trihydrate, Life Technologies, H3570) in water for 20 min ...
-
bioRxiv - Cell Biology 2020Quote: ... and induced to differentiate in myotubes for 2-3 days in differentiation media (DM: IMDM (Gibco, 21980-032) + 2% of horse serum (Gibco ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were treated with DMNB-caged cAMP (4,5-Dimethoxy-2-Nitrobenzyl Adenosine 3’,5’-Cyclicmonophosphate, Molecular Probes, D1037) for at least 30 minutes prior to imaging at a final concentration of 1 mM ...
-
bioRxiv - Immunology 2020Quote: Cell viability was estimated by a quantitative colorimetric assay described for human granulocytes which were based on metabolic reduction of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, Invitrogen) into coloured product formazan (Oez ...
-
bioRxiv - Developmental Biology 2022Quote: ... They were then immobilized on glass slides using 2% agarose and injected with 1,1’-dioctadecyl-3,3,3′,3′-tetramethylindocarbocyanine perchlorate (DiI, Molecular Probes) or 3,3′-dioctadecyloxacarbocyanine perchlorate (DiO ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were washed twice with PBS and loaded with 3 µM Fura-2 AM (Thermo Fisher, Waltham, MA) diluted in a modified Krebs-Ringer buffer solution [KRBH ...
-
bioRxiv - Plant Biology 2022Quote: ... equipped with an Acclaim Pepmap C18 trap column (2 cm · 75 µm, particle size: 3 µm; Thermo Fisher) and a C18 analytical column (50 cm · 75 µm ...
-
bioRxiv - Immunology 2022Quote: ... Primary B cells were plated at 2-3×106 cells/ml in primary B cell medium (DMEM (Gibco) containing 10% FBS (Sigma) ...
-
bioRxiv - Genetics 2023Quote: ... 3-5 million cells or approximately 15 ug of DNA crosslinked with 2% PFA (Fisher Scientific F79-500) were used as input per reaction ...
-
bioRxiv - Genomics 2023Quote: ... All nuclei were pooled and stained with DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306). Using a FACSAria III cell sorter (BD Biosciences) ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were treated with DMNB-caged cAMP (4,5-Dimethoxy-2-Nitrobenzyl Adenosine 3’,5’-Cyclicmonophosphate, Molecular Probes, D1037) for at least 30 min prior to imaging at a final concentration of 1 mM ...
-
bioRxiv - Biophysics 2023Quote: ... in 3% BSA with a 1:50 ratio and 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) were employed ...
-
bioRxiv - Cancer Biology 2023Quote: Cell proliferation was assayed by reduction of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Invitrogen, M6494). MTT was freshly dissolved into PBS at a stock concentration of 12 mM and diluted into phenol red-free DMEM with 10% FBS for a final MTT concentration of 2 mM ...
-
bioRxiv - Biochemistry 2022Quote: ... 2-3 µL of 5 µM protein solution was introduced directly into Q-Exactive UHMR mass spectrometer (ThermoFisher) through gold coated capillary needles that were prepared in-house30 ...
-
bioRxiv - Microbiology 2023Quote: ... Proteins were migrated for 2-3 h at 120 V in NuPAGE MOPS SDS running buffer (#NP0001, Invitrogen) and transferred onto a PVDF membrane (#1704156 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Molecular Biology 2023Quote: ... Mix 1 contains 3 siRNAs (CliniSciences, CRH7929) and Mix 2 contains two siRNAs (ThermoFisher Scientific, 1299001 and 4392420). As a negative control ...
-
bioRxiv - Biochemistry 2023Quote: ... cells were marked with 2,3x10-3 µg/µL 4’,6-Diamidino-2-phenylindole dihydrochloride (DAPI, Thermo Fisher Scientific) for 10 min at RT in the dark ...
-
bioRxiv - Plant Biology 2023Quote: ... 3 µg RNA from each sample was used to mix with 2×RNA loading dye (Thermo Fisher Scientific), denatured at 65℃ for 10 min ...
-
bioRxiv - Genomics 2024Quote: ... Fresh medium was added every 2-3 days and cells were passaged using 1X TrypLE Express (Life Technologies).
-
bioRxiv - Microbiology 2024Quote: ... The filtrate was acidified to a pH of 2-3 with OmniTrace HCl (ThermoFisher Scientific, Waltham, MA, USA) and extracted via solid phase extraction with styrene-divinylbenzene polymer columns (Bond Elut PPL ...
-
bioRxiv - Cell Biology 2024Quote: ... and a lentiviral transfer plasmid (2:3:4 ratio by mass) using Lipofectamine 3000 (Thermo Fisher Scientific L3000015). Viral supernatant was harvested 48h after transfection and filtered through 0.45 µm cellulose acetate filters (Corning 431220) ...