Labshake search
Citations for Thermo Fisher :
9651 - 9700 of 10000+ citations for 7 Chloromethyl 2 2 dimethyl 2 3 dihydro 1 benzofuran since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2024Quote: ... at a 6:1:2 ratio for each virus using the Bac-to-Bac baculovirus expression system (Thermo Fisher). Cell cultures were grown in ESF 921 medium (Expression Systems ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by cell viability staining with LIVE/DEAD™ Fixable Blue/Violet (2 µl/ 1×106cells) (Invitrogen, ThermoFisher Scientific) for 20 minutes at room temperature in darkness ...
-
bioRxiv - Immunology 2024Quote: 2×106 THP-1 cells were centrifuged for 5 min at 1200 rpm and washed in 1X PBS (Gibco). They were then transfected by nucleofection with 3 μg of plasmid DNA in 100 μl of Cell Line Nucleofector Solution V (Lonza ...
-
bioRxiv - Developmental Biology 2024Quote: ... incubated at room temperature for 2 hours in the secondary antibodies (Alexa 488 Donkey anti-Chicken, 1/200, Invitrogen; and CY3 Donkey anti-rabbit ...
-
bioRxiv - Cell Biology 2024Quote: ... worms were immobilized on 2% agar pads on microscope slides in ∼1 μl of 100 mM levamisole (ThermoFisher #AC187870100) and then coverslip applied.
-
bioRxiv - Microbiology 2024Quote: ... Supernatants issued from TSST-1 challenge were assessed for IL-2 concentration by enzyme-linked immunosorbent assay (ELISA) according to manufacturer’s protocol (Invitrogen). The plates were read at 450nm and 570nm in Biotek Synergy H4 multimode plate reader.
-
bioRxiv - Pathology 2024Quote: ... Cells were incubated with 5 µM Fura-2-AM in 1 mL RPMI B27 + Insulin (Thermo Fisher Scientific 17504044) at 37°C for 20 minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... Slides were then incubated for 2 hours in goat anti-rabbit 647 secondary antibody (1:400, Invitrogen A-21245). All immunohistochemistry steps were performed at room temperature.
-
bioRxiv - Microbiology 2024Quote: Sterilized seeds were placed on petri dishes containing 1/2 MS (Caisson, Smithfield, UT, USA; CatNo. MSP01-50LT) with 1.5% phytagel (Invitrogen, Waltham ...
-
bioRxiv - Microbiology 2024Quote: ... 2 μl of each Primer (40 pmoles) and 1 μl of PfuTurbo DNA Polymerase (2.5 U/μl) (Invitrogen, USA). The total volume was adjusted to 50 μl using nuclease-free water (Ambion ...
-
bioRxiv - Neuroscience 2024Quote: ... and 1-2 days with Alexa Fluor 647 mouse (A21235) and 488 rabbit (A11008) secondary antibodies (Thermo Fisher Scientific). After imaging with a Zeiss 900 upright confocal with 20x 1.0 NA water-dipping objective ...
-
bioRxiv - Neuroscience 2024Quote: ... Appropriate volumes of lysate (1-2 μg of protein per μl) in 1x SDS sample buffer (Thermo Fisher Scientific) were heat-denatured 95 °C ...
-
bioRxiv - Neuroscience 2024Quote: ... a stock solution (1 mM in DMSO) of membrane-permeant acetoxymethyl ester Fura-2 AM (Life Technologies, Eugene OR) was prepared and diluted to 8 µM in 1 ml of fresh growth medium (see Primary hippocampal cultures) ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were minced to a size of 0.5-1 mm3 and digested in Advanced DMEM+++ supplemented with 2% fetal bovine serum (Gibco), 2 mg/ml collagenase-P (Sigma-Aldrich) ...
-
bioRxiv - Physiology 2024Quote: ... Slides were then stained with DAPI (1:10,000; 4’, 6-diamidino-2-phenylindole; Cat. No. D3571; Thermo Fisher Scientific) for 10 minutes at room temperature and mounted with glass coverslips using 1:1 PBS and glycerol as mounting medium ...
-
bioRxiv - Neuroscience 2024Quote: ... using the digital stereotactic apparatus 1 μl of 2 mg/ml biotinylated dextran amine (BDA; MW 10,000; Molecular Probes) in PBS was injected at 6 specific coordinates (3 sites/side ...
-
bioRxiv - Microbiology 2024Quote: ... a single wasp was homogenized in 40 μl of buffer (10 mM Tris-Cl pH 8.2, 1 mM EDTA, 25mM NaCl) containing 2 mg/ml proteinase K (Invitrogen). The lysates were incubated for 15 min at 65 °C ...
-
bioRxiv - Neuroscience 2024Quote: Harvested plasma samples were lysed with 2% SDS in 1× TBS (25 mM Tris, 0.15 M NaCl, pH 7.2; Thermo Scientific) supplemented with a 1 × protease inhibitor cocktail ...
-
bioRxiv - Neuroscience 2024Quote: ... Time-lapse videos were recorded at 25 Hz for 5□min at 37□°C and 5% CO2 in culture media (Neurobasal media, 2% B27, 0.5□mM Glutamate, and 1% Penicillin/Streptomycin (Gibco)) ...
-
bioRxiv - Physiology 2024Quote: ... Slides were then stained with DAPI (1:10,000; 4’ ,6-diamidino-2-phenylindole; cat. no. D3571; Thermo Fisher Scientific) for 10 minutes at room temperature and mounted with glass coverslips using 1:1 PBS and glycerol as mounting medium ...
-
bioRxiv - Immunology 2024Quote: ... Antigens were separately diluted down to a concentration of 60nM in 50µl of the 2:1 ratio of RPMI media (Gibco) + FLIPR Calcium 6 dye (Molecular Devices ...
-
bioRxiv - Immunology 2024Quote: ... The supernatant was then decanted and the cells were resuspended at a 2:1 ratio of RPMI media (Gibco) + FLIPR Calcium 6 dye (Molecular Devices) ...
-
bioRxiv - Bioengineering 2024Quote: ... T cells were cultured at a 1:2 cell:bead ratio with cultured αCD3/αCD28 activator beads (Thermo Fisher Scientific) and 50 ng/mL recombinant IL-2 (BioLegend ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... samples were incubated in Tyramide development solution (2% Dextran sulfate, 0.0015% hydrogen peroxide, 0.2mg/ml Iodophenol, 1:100 Alexa Fluor 488 Tyramide (ThermoFisher # B40953) in PTw ...
-
bioRxiv - Bioengineering 2024Quote: ... PEGαMA hydrogels were made by dissolving the PEGαMA in pH 8.4 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES; Life Technologies) at 12.5-15.5 weight percent (wt%) ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were resuspended in 1 mL cold lysis buffer per plate (20 mM HEPES-NaOH pH 7.9, 150 mM NaCl, 2 mM EDTA, 0.1% Triton X-100, 1 mM PMSF added fresh, 1X Thermo Scientific HaltTM Protease Inhibitor Cocktail added fresh) ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were transfected with the Cas9 plasmids and Cas13 plasmids (1:2 ratio) using Lipofectamine 2000 (Invitrogen; #11668-027) for 24 hours before RNA extraction ...
-
bioRxiv - Molecular Biology 2024Quote: ... shZBP1-2 GCACAATCCAATCAACATGAT within the pLKO.1 vector (MiliporeSigma, TRCN0000123050) were transfected into HVECs using Lipofectamine 3000 (Invitrogen, L3000001). After transfection ...
-
bioRxiv - Immunology 2024Quote: ... envelope (1.25 μg) and delta envelope plasmids (2.50 μg) were mixed in a 1:2 ratio in Opti-MEM (Gibco), with a final volume of 200μl per well ...
-
bioRxiv - Developmental Biology 2024Quote: ... Seeded cultures were incubated for 2 hours before adding 500µl media (DMEM [Thermo Fisher, 11995065]; 1% Pen Strep [Gibco 15-140-163] ...
-
bioRxiv - Cancer Biology 2024Quote: ... and run for 1-2 hours at 100V in parallel with GeneRuler1 kb Plus DNA Ladder (Thermo Fisher, UK). Gels were imaged using a Syngene Gel Doc system.
-
bioRxiv - Cell Biology 2024Quote: ... a 1 cm segment of intestinal tissue was minced and digested in 2 mg/ml Collagenase I solution (Invitrogen) with Gentamicin (Sigma ...
-
bioRxiv - Cancer Biology 2024Quote: ... About 1 μg tryptic peptides in 10 μL solution was loaded onto a 2 cm trap column (Thermo Scientific) and then separated on a 50 cm EASY-Spray analytical column (Thermo Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... The constructed plasmids pGEM-H3.1-HaloTag and pX330-H3.1-gRNA were electroporated into the 10T1/2 cells using the Neon Transfection System (Invitrogen). The 10T1/2 clone stably expressing mouse H3.1-HaloTag was selected as described above ...
-
bioRxiv - Bioengineering 2024Quote: ... and eluted in 20 μL H2O, before predigestion (1 μg extended barcode, 2 μL Esp3I (Thermo Fisher Scientific, FD0454), 2 μL 10X FastDigest buffer (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2024Quote: ... 4 μl of 5x First Strand buffer (Y02321) + 1 μl RNaseOUT Recombinant Ribonuclease Inhibitor (40 units/ μl) (100000840) + 2 μl 0.1 M DTT (Y00147) from Invitrogen were added and incubated for 1 minute at 42°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... caspase-3 and caspase-7 green apoptosis-assay reagent (Life Technologies) was added to the culture medium following manufacturer’s instructions ...
-
bioRxiv - Zoology 2021Quote: ... and CellEvent Caspase-3/7 Green ReadyProbes Reagent (ThermoFisher Scientific, R37111) (CellEvent ...
-
bioRxiv - Immunology 2024Quote: ... CellEvent™ Caspase-3/7 Green Detection Reagent (Thermo Fisher, C10423) was added to cultures at 20 μM and incubated for 30 min at 37°C ...
-
bioRxiv - Bioengineering 2021Quote: ... in dimethyl sulfoxide (Thermo Fisher) at a 40-molar excess of D-biotin to streptavidin and incubation for 30 minutes while shaking at 600 RPM.
-
bioRxiv - Developmental Biology 2024Quote: ... dimethyl sulfoxide (DMSO, Thermo Scientific), acrylamide (AAm ...
-
bioRxiv - Biochemistry 2024Quote: ... resuspended in lysis buffer (50 mM sodium phosphate, 500 mM NaCl, 20 mM imidazole, 2 mM MgCl2, 10% glycerol [vol/vol, Fisher Scientific], 0.5 mM ATP, 5 mM 2-ME, pH 7.4) supplemented with 20 µg ml-1 DNAse I ...
-
bioRxiv - Microbiology 2020Quote: ... that had been supplemented with 2% FBS (Gibco, Life Technologies, Grand Island, NY), 2mM L-glutamine (Gibco ...
-
bioRxiv - Microbiology 2020Quote: ... that had been supplemented with 2% FBS (Gibco, Life Technologies, Grand Island, NY), 2mM L-glutamine (Gibco ...
-
bioRxiv - Microbiology 2020Quote: Mice were injected with 100 μg of 5-ethynyl-2’deoxyuridine (EdU, Invitrogen) 2 hours prior to splenocyte harvest ...
-
bioRxiv - Plant Biology 2020Quote: ... Organic acids were separated using an IonPac AS11-HC (2 mm, Thermo Scientific) column connected to an ICS-5000 system (Thermo Scientific ...
-
bioRxiv - Biophysics 2021Quote: ... The electroporation was executed in a 2 mm-gap electroporation cuvette (Invitrogen, P45050) by Amaxa Nucleofector II following manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2020Quote: Figure 2: Total RNA was isolated from cells or embryos using Trizol (Ambion by Life Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... three small cell culture dishes (2 mm grid, Nalge Nunc International, Rochester, USA) were filled with the cell preparation and placed in a large cell culture dish ...
-
bioRxiv - Microbiology 2020Quote: ... sample was loaded onto a 2 cm Acclaim PepMap 100 (Thermo Fisher Scientific) trap (75 µm ID ...