Labshake search
Citations for Thermo Fisher :
9601 - 9650 of 10000+ citations for 7 Chloromethyl 2 2 dimethyl 2 3 dihydro 1 benzofuran since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... Larvae were then kept at 28.5°C with fresh E3 medium supplemented with 0.2 mM 1-phenyl-2-thiourea (10107703, Acros Organics). Around 3-4 hours after heat-shock ...
-
bioRxiv - Developmental Biology 2024Quote: R-follicles were incubated for 1 hour in Maintenance Media containing freshly prepared 2 µM Calcein-AM (C3100MP, Invitrogen). Subsequently ...
-
bioRxiv - Neuroscience 2024Quote: ... Approximately 1 μg of RNA per sample (10.6 µL) was incubated with 2 µL TURBO DNase (Thermo Fisher Scientific) and 1.4 µL TURBO DNase buffer (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... and incubated in goat anti-rabbit Alexa Fluor 568 secondary antibody (1:200 in 2% BSA and 0.1% Triton; Invitrogen) overnight at 4°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... The Dynabeads were washed three times with 1 ml of NPB using a DynaMag-2 magnet (#12321; ThermoFisher Scientific), with each wash performed after 1 minute of incubation ...
-
bioRxiv - Cell Biology 2024Quote: ... and RT was performed with 1-2 μg RNA using SuperScript™ IV VILO™ Mastermix (11756050, Thermo Fisher) with the following conditions ...
-
bioRxiv - Microbiology 2024Quote: Recombinant soluble spike and RBD proteins from Wuhan-1 and BA.1 SARS-CoV-2 strains were expressed as described 58,59 Recombinant proteins were produced in Expi293F cells (ThermoFisher) by transfection of DNA using the ExpiFectamine 293 Transfection Kit (ThermoFisher) ...
-
bioRxiv - Cell Biology 2024Quote: ... for immunofluorescence analysis or were lysed in IGEPAL-C360 lysis buffer (20 mM Tris HCl pH 8.1, 37 mM NaCl, 1% IGEPAL-C360, 10% glycerol, 2 mM EDTA supplemented with protease inhibitor cocktail from ThermoFisher) for immunoblotting.
-
bioRxiv - Cell Biology 2024Quote: ... About 1-2 μg indicated plasmid was used according to the instruction of lipofectamine 3000 (Thermo Fisher Scientific, USA).
-
bioRxiv - Cell Biology 2024Quote: ... activated and unactivated iPSC-Tregs were co-cultured with activated (2:1 beads:cells) Tconv labeled with Cell Trace Violet (Thermofisher) in X-VIVO15 media supplemented with pen/strep ...
-
bioRxiv - Developmental Biology 2023Quote: ... and incubated with DMEM supplemented with 1% Pen/Strep and 2% (v/v) horse serum (Gibco, differentiation medium, DM) at the same condition for differentiation ...
-
bioRxiv - Immunology 2023Quote: ... PANC-1 and MiaPaCa-2 were cultured and maintained in growth medium [DMEMF/12 with GlutaMAX™ Supplement (Gibco), + 10% v/v Heat Inactivated Fetal Bovine Serum (FBS ...
-
bioRxiv - Neuroscience 2023Quote: ... Slides were subsequently incubated for 2 hours in secondary antibodies (all 1:500; Thermo Fisher Scientific, Waltham, MA, USA) diluted in 5% FBS ...
-
bioRxiv - Neuroscience 2024Quote: ... cells were dissociated and plated (1:2 ratio) at high density and maintained in maturation media (Neurobasal media (Gibco) + B27 supplement (Gibco ...
-
bioRxiv - Microbiology 2023Quote: ... the sections were incubated with SARS-CoV-2 antibody against the nucleocapsid (N) protein (ThermoFisher MA536086; 1:28,000 dilution) for 15min at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... inoculation of 2×106 THP-1 cells expressing firefly luciferase and GFP in 100 μL of PBS (Gibco, USA). Mice were randomly assigned to 4 experimental groups and 1 control group ...
-
bioRxiv - Cancer Biology 2023Quote: ... THP-1 cells were cultured in R10 supplemented with 0.05 mM 2-mercaptoethanol (21985023; Thermo Fisher Scientific, Waltham, MA). MV-4-11 cells were cultured in IMDM supplemented with 10% FBS ...
-
bioRxiv - Microbiology 2023Quote: ... sonicated in 1-2% SDS at 37 kHz and 100% power in a Fisherbrand™ bath sonicator (Fisher Scientific) for 10 minutes ...
-
bioRxiv - Physiology 2023Quote: ... the sections were incubated with 4’,6-diamidino-2-phenylindole (DAPI; D1306, Thermo Fisher Scientific; 1:1000 in PBS) for 2min at room temperature to counterstain the nucleus before being washed twice in PBS ...
-
bioRxiv - Cell Biology 2023Quote: Slides were rehydrated with dPBS for 2 minutes before incubation in 1:500 wisteria floribunda agglutinin (Invitrogen, Waltham, MA) overnight at room temperature in the dark in a humidified chamber ...
-
bioRxiv - Plant Biology 2024Quote: DAPI (4′,6-diamidino-2-phenylindole) solution: Dilute 1 mg/ml DAPI (ThermoFisher, Cat. No. 62248, Rockford, IL, USA) to a final concentration of 0.5 µg/ml in 1x PBST (0.1% Tween-20).
-
bioRxiv - Bioengineering 2022Quote: ... Half of the medium was replaced by pre-warmed PBS containing 2 μL Hoechst (1 mg/mL Thermofisher Scientific). After 30 min incubation ...
-
bioRxiv - Biophysics 2022Quote: ... coverslips were incubated for 2 hours in a 1:1000 dilution of secondary antibody (anti-rabbit Alexa 647, Invitrogen, A-27040 ...
-
bioRxiv - Cancer Biology 2022Quote: ... thinly sliced (1-2 mm) tissue samples were fixed overnight at 4°C in neutral-buffered formalin (Fisher Scientific) with PhosSTOP added (Roche) ...
-
bioRxiv - Cell Biology 2022Quote: ... the mice were perfused for 1 min to 2 min with Hank’s balanced salt solution (14025-050; ThermoFisher Scientific), followed by 5 min perfusion with 4% paraformaldehyde (PFA ...
-
bioRxiv - Cell Biology 2022Quote: ... was transfected into Lenti-x 293T cells with 2:1 (psPAX2/pMD2G) plasmids using Lipofectamine 2000 (Thermo Fisher # 12566014) at a ratio of 1:1 (Lipofectamine 2000/nucleic acid (μg) ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were trypsinized and plated onto coverslips (1:2 split) or Nunc 8 well chamber slides (Thermo Fisher # 155409PK) (20-40k cells per well).
-
Alpha-1-antitrypsin binds to the glucocorticoid receptor with biological significance in macrophagesbioRxiv - Immunology 2022Quote: Human THP-1 cells were cultured in RPMI-1640 medium containing 2 mM L-glutamine (Gibco; Grand Island, NY), 10% FBS ...
-
bioRxiv - Molecular Biology 2022Quote: Drosophila Schneider 2 (S2) lines were maintained in 1 X Schneider’s medium supplemented with 10% heat inactivated fetal bovine serum (Gibco) and 50 mg/ml gentamicin antibiotic (Gibco) ...
-
bioRxiv - Neuroscience 2022Quote: ... Beads were resuspended in 400 μl NET-2 and extracted with an equal volume of phenol:chloroform:isoamyl 25:24:1 (Invitrogen 15593031). After centrifugation at 16,000 x g for 15 minutes ...
-
bioRxiv - Plant Biology 2023Quote: ... Fura-2 fluorescence was calibrated with defined Ca2+ buffers generated with the Ca2+ Calibration Kit #1 (Invitrogen, Waltham, USA).
-
bioRxiv - Neuroscience 2023Quote: ... followed by 2 h incubation with fluorescent secondary antibodies (Fluor 568 labeled donkey anti-mouse (1:500; Life Technologies), Fluor 488 labeled donkey anti-rabbit (1:500 ...
-
bioRxiv - Biochemistry 2023Quote: ... coverslips were stained for 5 min with 1 μg/ml 300 nM 4′,6-diamidino-2-phenylindole (Life Technologies) to visualize nuclei ...
-
bioRxiv - Genetics 2023Quote: ... PCR amplicons were resolved by 1–2% agarose gel electrophoresis and visualized by staining with SYBR Safe (Thermo Scientific). Negative control samples were always analyzed in parallel with experimental samples to identify mis-priming products ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cell pellets were finally resuspended in wash buffer containing 1 µg/ml 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen) or 7-AAD viability dye (BioLegend ...
-
bioRxiv - Cell Biology 2023Quote: ... for 5 min and hybridized with smFISH probes diluted 1:3000 in hybridization buffer (10% dextran sulfate, Sigma D8906, 20% formamide, 1 mg/ml E. coli tRNA, Sigma R1753, 2× SSC, 0.02% BSA, Ambion AM2616 ...
-
bioRxiv - Microbiology 2023Quote: ... resuspended in 1:5000 dilution of Alexa Fluor 488 labeled goat anti-rabbit IgG 2° Ab (Invitrogen, A-11070) with blocking buffer and incubated for 30 min at 4°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... all applicable cell lines were selected using Puromycin (L929 – 10μg/mL, C3H – 1 ug/mL, NIH3T3 2 μg/mL, ThermoFisher) and Hygromycin B (L929 ...
-
bioRxiv - Immunology 2024Quote: 2×106 THP-1 cells were centrifuged for 5 min at 1200 rpm and washed in 1X PBS (Gibco). They were then transfected by nucleofection with 3 μg of plasmid DNA in 100 μl of Cell Line Nucleofector Solution V (Lonza ...
-
bioRxiv - Developmental Biology 2024Quote: ... incubated at room temperature for 2 hours in the secondary antibodies (Alexa 488 Donkey anti-Chicken, 1/200, Invitrogen; and CY3 Donkey anti-rabbit ...
-
bioRxiv - Cell Biology 2024Quote: ... worms were immobilized on 2% agar pads on microscope slides in ∼1 μl of 100 mM levamisole (ThermoFisher #AC187870100) and then coverslip applied.
-
bioRxiv - Cancer Biology 2024Quote: ... followed by cell viability staining with LIVE/DEAD™ Fixable Blue/Violet (2 µl/ 1×106cells) (Invitrogen, ThermoFisher Scientific) for 20 minutes at room temperature in darkness ...
-
bioRxiv - Biophysics 2024Quote: ... Cells were seeded on glass petri-bound hydrogels prepared with 1 µl/ml of 0.1% FluoSpheres Carboxylate-modified microspheres (0.2 µm, 580/605, 2%) (Thermo Fisher) aqueous solution ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by cell viability staining with LIVE/DEAD™ Fixable Blue/Violet (2 µl/ 1×106cells) (Invitrogen, ThermoFisher Scientific) for 20 minutes at room temperature in darkness ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... samples were incubated in Tyramide development solution (2% Dextran sulfate, 0.0015% hydrogen peroxide, 0.2mg/ml Iodophenol, 1:100 Alexa Fluor 488 Tyramide (ThermoFisher # B40953) in PTw ...
-
bioRxiv - Bioengineering 2024Quote: ... T cells were cultured at a 1:2 cell:bead ratio with cultured αCD3/αCD28 activator beads (Thermo Fisher Scientific) and 50 ng/mL recombinant IL-2 (BioLegend ...
-
bioRxiv - Bioengineering 2024Quote: ... PEGαMA hydrogels were made by dissolving the PEGαMA in pH 8.4 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES; Life Technologies) at 12.5-15.5 weight percent (wt%) ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were resuspended in 1 mL cold lysis buffer per plate (20 mM HEPES-NaOH pH 7.9, 150 mM NaCl, 2 mM EDTA, 0.1% Triton X-100, 1 mM PMSF added fresh, 1X Thermo Scientific HaltTM Protease Inhibitor Cocktail added fresh) ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were transfected with the Cas9 plasmids and Cas13 plasmids (1:2 ratio) using Lipofectamine 2000 (Invitrogen; #11668-027) for 24 hours before RNA extraction ...
-
bioRxiv - Molecular Biology 2024Quote: ... shZBP1-2 GCACAATCCAATCAACATGAT within the pLKO.1 vector (MiliporeSigma, TRCN0000123050) were transfected into HVECs using Lipofectamine 3000 (Invitrogen, L3000001). After transfection ...