Labshake search
Citations for Thermo Fisher :
751 - 800 of 10000+ citations for Human integrin alpha 5 beta 3 His tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... and 5 ng/uL human IL-6 recombinant protein (ThermoFisher PHC0066).
-
bioRxiv - Molecular Biology 2020Quote: ... 5% CO2 for 24 h before transient transfection with plasmids encoding Affimer-His constructs using Lipofectamine 2000 (ThermoFisher), as per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... primary DP cells from P5-8 Tgfbr2fl/fl molars were grown in alpha-minimum essential medium (alpha-MEM; Gibco) supplemented with 10% heat-inactivated fetal bovine serum ...
-
bioRxiv - Cancer Biology 2022Quote: ... fetal liver cells were thawed and cultured for 48 h in alpha-minimum essential media (alpha-MEM) Glutamax (Gibco) containing 10% FCS ...
-
bioRxiv - Genetics 2024Quote: ... The final digest was placed in a plastic cell culture dish with alpha modified Eagle’s medium (alpha-MEM) (Invitrogen) supplemented with 10% fetal bovine serum (Gibco) ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were incubated with an alpha tubulin monoclonal antibody conjugated to Alexa Fluor 488 (B-5-1-2, Invitrogen, Carlsbad, CA) at 2 μg/mL in 1% BSA in PBS for 1 hour ...
-
Corticocortical Connections of the Rostral Forelimb Area in Rats: A Quantitative Tract-Tracing StudybioRxiv - Neuroscience 2020Quote: ... Cholera toxin beta subunit conjugated to AlexaFluor 647 (CTB647, 5 µg/µL in 0.9% sterile saline, C34778, Invitrogen, Grand Island, NY) was injected (with the same configuration and outside diameter as BDA10kDa ...
-
bioRxiv - Biochemistry 2023Quote: ... Dried cell lysate was digested using a solution of 5 nanogram/microliter LCMS grade trypsin (Pierce) in 0.1% n-Dodecyl-beta-Maltoside Detergent (DDM, Thermo Fisher, 89902) and 50mM TEAB ...
-
bioRxiv - Biochemistry 2023Quote: ... Dried lysed cellular lysate was digested using a solution of 5 nanogram/microliter LCMS grade trypsin (Pierce) in 0.1% n-Dodecyl-beta-Maltoside Detergent (DDM, Thermo Fisher, 89902) and 50mM TEAB ...
-
bioRxiv - Biochemistry 2023Quote: ... Dried cell lysate was digested using a solution of 5 nanogram/microliter LCMS grade trypsin (Pierce) in 0.1% n-Dodecyl-beta-Maltoside Detergent (DDM, Thermo Fisher, 89902) and 50mM TEAB ...
-
bioRxiv - Cancer Biology 2020Quote: ... as per the commercial protocol) and 5 μL of fluorescent tag kit (Alexa Fluor® succinimidyl esters, Invitrogen, Molecular Probes® ...
-
bioRxiv - Neuroscience 2020Quote: ... for 48 h then transfected for 24 h with 1 ug His-G3BP1 3’UTR constructs using Lipofectamine LTX and Plus reagent (Invitrogen). To determine mRNA stability ...
-
bioRxiv - Immunology 2023Quote: ... which encodes for a C-terminal C-Direct tag containing a free thiol (cysteine) and an EPEA (Glu, Pro, Glu, Ala) purification tag (C-tag, Thermo Fisher Scientific). Vectors were transformed into yeast cells (Saccharomyces cerevisiae strain VWK18 (51)) ...
-
bioRxiv - Biophysics 2020Quote: The DNA sequences of the human CE GTase and each sequence variant were synthesised and subcloned into the PGEX6p1-C-His plasmid vector by Thermo Fisher GeneArt ...
-
bioRxiv - Neuroscience 2021Quote: His-tagged human dynamin 1 was expressed using the Bac-to-Bac baculovirus expression system (Thermo Fisher Scientific, Waltham, MA, USA) and purified as described previously (66) ...
-
bioRxiv - Physiology 2021Quote: ... The human full-length BACE1 or BACE2 cDNAs were expressed from the pcDNA3.1/myc-His expression vector (Invitrogen, Waltham, MA, USA).
-
bioRxiv - Immunology 2019Quote: ... from RNA extracted from peripheral blood mononuclear cells (PBMCs) utilizing the following primers: forward 5’-GAGAATTCACCATGACTATGGAGACCCAAATG-3’ and reverse 5’-CGTACGCCCCATTGGTGAAGAGCTGCC-3’ (Thermo Fisher Scientific, Waltham, MA, USA). PCR product was fused by restriction enzyme-compatible ends with the CD8α-CD28-CD3ζ domain contained in the pcDNA3.1/V5-His TOPO TA (Invitrogen ...
-
bioRxiv - Developmental Biology 2022Quote: ... or DNAH9 (Primer; Sense: 5’-ACAGGCTGGTGCTGCAGGA-3’, SP6-antisense: 5’-gcgatttaggtgacactatagCAAAATGACGCTGGAGGGG-3’) using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Invitrogen, ThermoFisher Scientific, MA, USA) and a dig-dNTP mix (Roche ...
-
bioRxiv - Immunology 2019Quote: ... from RNA extracted from freshly isolated peripheral blood mononuclear cells (PBMCs) utilizing the following primers: forward 5’-GAGAATTCACCATGACTATGGAGACCCAAATG-3’ and reverse 5’-CGTACGCCCCATTGGTGAAGAGCTGCC-3’ (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was fused in tandem by restriction enzyme-compatible ends with the CD8α transmembrane domain and the CD28 and CD3ζ intracellular regions already available in the lab (CD32131R-CR) ...
-
bioRxiv - Biochemistry 2023Quote: ... cyriacigeorgica clinical isolate responsible for pulmonary nocardiosis was used as a template for polymerase chain reaction (PCR) with primers 5’- gatatgcaccacggcctgca-3’ and 5’-acggcgacgaagaagcgga-3’ by using Invitrogen™ Platinum SuperFi II DNA Polymerase (Thermo Fisher Scientific, Illkirch, France). A second PCR was performed on the aforementioned amplicon to amplify the truncated version of NCY-1 with the following forward 5’-ggtaccgagaacctgtacttccagggttcggccgtggccgatccccggttcgccgcactggaaacg-3’and reverse 5’- gtggtgctcgagctaaccgagcacgtcgacgaccgtcctggtcgcgtcggc-3’primers ...
-
bioRxiv - Developmental Biology 2020Quote: ... Tgfβ-3(Cat# Mm00436960) alpha-SMA (Cat# Mm00725412) and Vegf (Cat# Mm00437306_m1) Single Tube TaqMan® Gene Expression Assays (Life Technologies Thermo Fisher Scientific) were used ...
-
bioRxiv - Biophysics 2022Quote: ... Cells were rinsed 3 times by 1X PBS and labeled with 500 μL of 1:100 anti-alpha Tubulin primary antibody (Thermo Fisher Scientific, 322500), 1:200 anti-Tomm20 primary antibody (Abcam ...
-
bioRxiv - Biochemistry 2022Quote: ... His-tagged CDC50A was detected using a His-probeTM -HRP from Thermo Scientific (15165). Precast stain-free gradient gels for tryptophan fluorescence (4568084 ...
-
bioRxiv - Genomics 2019Quote: ... cDNA was fragmented and labeled with a 3’ biotin tag before quantifying gene expression using Affymetrix custom tiling arrays (A-AFFY-116 - Affymetrix Custom Array - S ...
-
bioRxiv - Neuroscience 2022Quote: ... 5’ – CCT GAA ATC GCT GAT GTG TAG TCG TCA GTC AGT GGC CAA AAC GAC TAC ACA AAT CAG CGA TTT C - 3’) obtained from Invitrogen. The miRNA plasmids were then sub-cloned into an AAV2 expression backbone downstream of a CMV promoter and of an EYFP reporter sequence ...
-
bioRxiv - Cell Biology 2023Quote: ... ALFA-FAM134s were targeted directly using an anti-ALFA nanobody carrying a 5xR1 docking strand (5-TCCTCCTCCTCCTCCTCCT-3’) (Massive-TAG-Q Anti-ALFA Custom, Massive Photonics, GmbH) which was diluted in permeabilization/blocking buffer (10% FCS (Gibco), 0.1% saponin (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2021Quote: ... residues 306–577 of MERS-CoV S with a C-terminal monomeric human IgG Fc-tag and an 8x HisTag (SARS-CoV RBD-SD1) were transiently transfected into FreeStyle293F cells (Thermo Fisher) using polyethylenimine ...
-
bioRxiv - Biophysics 2021Quote: Human wild type ABCG2 or ABCG2 R184A containing an N-terminal Flag-tag was expressed in HEK293-EBNA (Thermo Fisher Scientific) cells as previously described19 ...
-
bioRxiv - Immunology 2021Quote: ... Extracellular fragment of human CD4 comprising domains 1-4 of human CD4 and a C-terminal His6-tag was expressed in Expi293 cells according to the manufactureŕs protocol (Thermo Fisher Scientific). Cell supernatant was harvested by centrifugation 4 days after transfection ...
-
bioRxiv - Immunology 2020Quote: ... or residues 319–591 of SARS-CoV-2 S with a C-terminal monomeric human IgG Fc-tag and an 8x HisTag (SARS-CoV-2 RBD-SD1) were transiently transfected into FreeStyle293F cells (Thermo Fisher) using polyethylenimine ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10% HI FBS (Gibco A31604), and pen/strep and seeded into 96-well plates 24 hr prior to treatment ...
-
bioRxiv - Neuroscience 2022Quote: ... and pcDNA3.1/myc-His (Invitrogen). Constructs for hTara mutants were prepared by cloning into pEGFP-C3 ...
-
bioRxiv - Bioengineering 2022Quote: ... Primary antibody (Anti-His; Invitrogen, Waltham ...
-
bioRxiv - Immunology 2022Quote: ... + 10% HI-FBS (Gibco, 16140071) + 10% HI-Horse Serum (Gibco ...
-
bioRxiv - Microbiology 2020Quote: ... mouse anti-His mAb (Invitrogen) and anti-GAPDH mAb (Life Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... and 0.5% HI FBS (Gibco). Neutrophils were recovered from the bottom of the tube.
-
bioRxiv - Microbiology 2023Quote: ... GFP-His (Thermo Fisher # A42613), NL63 N-His (Sino Biological # 40641-V07E) ...
-
bioRxiv - Molecular Biology 2023Quote: ... His-bind magnetic Dynabeads (Invitrogen) were washed with TBS containing 0.05% Tween-20 (TBS-T ...
-
bioRxiv - Microbiology 2022Quote: ... and 0.5% HI FBS (Gibco).
-
bioRxiv - Molecular Biology 2023Quote: ... anti-His (ThermoFisher scientific, rd230540a), anti-SETD6 (Genetex ...
-
bioRxiv - Cancer Biology 2023Quote: ... with 2% HI FBS (Gibco) and 0.4% 0.5M EDTA (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... and 10% HI FBS (Gibco). Media were supplemented with interleukin-2 (IL-2 ...
-
bioRxiv - Microbiology 2023Quote: ... Strep-tag (NBP2-41073; Novusbio) or influenza virus hemagglutinin tag (2-2.2.14; Thermo Scientific). After washing with PBS with 1% BSA ...
-
bioRxiv - Evolutionary Biology 2022Quote: The purified RNA was used to amplify cDNA from the gUTRGFP template with the 5’ Cy-5 labelled pWP252fluor primer (5’ ATAACGGACTAGCCTTA 3’) using the standard Superscript III First-Strand Synthesis System (Thermo Fisher) with 3 µg of total RNA and elongating at 52.5°C for 60 min ...
-
bioRxiv - Immunology 2021Quote: ... Anti-CD8-alpha (53-6.7) was from Invitrogen. Anti-CD11c (N418) ...
-
Reconstitution of prospermatogonial specification in vitro from human induced pluripotent stem cellsbioRxiv - Developmental Biology 2020Quote: ... in Minimum Essential Medium alpha (α-MEM) (Invitrogen) containing 10% KSR (Gibco) ...
-
bioRxiv - Microbiology 2020Quote: ... and anti-alpha-tubulin (MA1-8007, Thermo Scientific diluted 1:300 to 1:500 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and cultured in alpha-MEM (Life Technologies, 12571063) with 0.15 mM ascorbic acid (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2020Quote: ... 20 % MEM-alpha (12571063; Thermo Fisher Scientific, USA), 20 % DMEM/F12 (10565018 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were resuspended in 60µL MEM alpha (Gibco) before transplantation and monitored using micro CT as previously described(Zheng et al. ...