Labshake search
Citations for Thermo Fisher :
851 - 900 of 10000+ citations for 7H Benzocyclohepten 7 one 2 amino 5 6 8 9 tetrahydro 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... Cells were passaged every 5 or 6 days using Versene (Gibco, A4239101). Clinical hESCs were tested weekly for mycoplasma contamination using a Myco-detection Kit (InvivoGen ...
-
bioRxiv - Bioengineering 2024Quote: ... Coupling 5-(and 6)-Carboxytetramethylrhodamine (TAMRA) mixed isomers (Thermo Scientific, Waltham, MA) and Fmoc-8-amino-3,6-dioxaoctanoic acid (Fmoc-PEG2-OH ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... С6 and CHO/5-HT2C were maintained in the F12 medium (Invitrogen). In all cases ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 Bcl6 and 6 Smyd2 KO livers using TRIzol reagent (Invitrogen #15596026) followed by purification using the RNeasy Mini kit (Qiagen #74014) ...
-
bioRxiv - Bioengineering 2024Quote: ... Cells were split every 5-6 days using TrypLE Express (Gibco, #12604013). Each dome required 20-25mins in TrypLE Express with manual pipetting for successful dissociation ...
-
bioRxiv - Microbiology 2024Quote: ... and 6 µl Klenow-Fragment exo-polymerase (Thermo Fisher, 5 U/µl) were added ...
-
bioRxiv - Cancer Biology 2019Quote: ... 4 mM serine and essential amino acids (MEM Amino Acids Solution; Gibco, 11130036); for all other experiments ...
-
bioRxiv - Cell Biology 2023Quote: ... 9 µL of the reaction was stopped with 9 µL NuPAGE LDS Sample Buffer (Invitrogen) at 0 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... we used 20 amino acids that contained 2 mM of 13C6 15N2 L-lysine (Thermo Fisher Scientific) and 13C6 15N4 L-arginine (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2022Quote: ... 1% nonessential amino acids (1140050) and 50μM 2-mercaptoethanol (31350-010) (all Thermo Fisher Scientific unless specified), 1,000 U/ml LIF (ESGRO ESG1107 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were maintained in RF10: RPMI 1640 supplemented with 2 mM MEM nonessential amino acid solution (Gibco), 100 mM HEPES (Gibco) ...
-
bioRxiv - Systems Biology 2023Quote: ... 0.1 mM CaCl2 and either 10% Luria Broth (Figs 1&2) or MEM amino acids (from Gibco) (Figs 3–5) ...
-
bioRxiv - Genomics 2024Quote: ... 2 mM L-glutamine (PAN-P04-80100) and 1x MEM non-essential amino acid (Gibco 11140-35) solution ...
-
bioRxiv - Molecular Biology 2023Quote: ... MMP-2 and −9 activity was determined using gelatine containing zymography gels (Thermo Fisher Scientific, Karlsbad, CA, USA) as previously described (37).
-
bioRxiv - Cell Biology 2024Quote: ... 1.9 µm beads-EV1106 column using an Evosep one HPLC system coupled to an Orbitrap Eclipse Tribrid mass spectrometer (Thermo Fisher, San José, CA, USA) and a 30 SPD preprogramed gradient.
-
bioRxiv - Molecular Biology 2024Quote: ... 1.9 µm beads-EV1106 column using an Evosep one HPLC system coupled to an Orbitrap Eclipse Tribrid mass spectrometer (Thermo Fisher, San José, CA, USA) and a 30 SPD preprogramed gradient.
-
bioRxiv - Cell Biology 2020Quote: ... Sequencing was performed using Ion Proton instrument with 7 or 8 samples per chip with Ion PI Hi-Q Sequencing 200 Kit (ThermoFisher Scientific). Reads were aligned to the hg19 AmpliSeq Transcriptome ERCC v1 with Torrent Mapping Alignment Program (version 5.0.4 ...
-
bioRxiv - Biophysics 2023Quote: ... the media was removed and the cells were incubated with 8 µM CellEventTM Caspase 3-7 green detection reagent (Thermo Fisher) in PBS containing 5% FBS for 30 min at 37 °C ...
-
bioRxiv - Developmental Biology 2024Quote: ... Dissociated cells were blocked in 6% BSA and immunolabeled with anti-α3 antibody (mouse Anti-ATP1A3 xVIF 9-G10, MA3-915, Invitrogen, Thermo Fisher scientific) for 2 hours 200 times in PBS1x containing 1%BSA or at room temperature ...
-
bioRxiv - Cancer Biology 2021Quote: ... carrying the mutation R273C was first amplified by PCR using the primers hp53-1 (5’-CACCATGGAGGAGCCGCAGTCAGATCC-3’) and hp53-8 (5’-GGATCCTCAGTCTGAGTCAGGCCCTTCTGTCTTG-3’) and cloned into the pENTR/D-TOPO vector (ThermoFisher) generating the entry vector pENTR p53(R273C ...
-
bioRxiv - Cancer Biology 2019Quote: ... was cultured in RPMI with 5 % heat inactivated human serum (HS) and 2 ng/mL interleukin (IL)-6 (Gibco, Thermo Fisher Scientific, Waltham, MA, USA). In vitro experiments with KJON cells were performed with 2 % HS in RPMI and IL-6 (1 ng/mL) ...
-
bioRxiv - Cell Biology 2021Quote: ... dried peptide sample was resuspended in 200 mM HEPES (pH 8) and incubated for 1 h at room temperature with one of the TMT10-plex reagents (ThermoFisher) solubilized in 100% anhydrous ACN ...
-
bioRxiv - Immunology 2022Quote: ... 8-16 barcoded samples were pooled and loaded on one Ion 530 chip using the Ion Chef Instrument (ThermoFisher Scientific) and sequenced on the Ion S5 System with 550 flows.
-
The RNA-binding protein RbpB is a central regulator of polysaccharide utilization in gut BacteroidesbioRxiv - Microbiology 2023Quote: ... The alkaline hydrolysis ladder was prepared by incubating 0.4 pmol 5’ end-32P-labeled RNA in 9 µL of 1x alkaline hydrolysis buffer (Ambion) for 5 min at 95°C ...
-
bioRxiv - Microbiology 2024Quote: ... and cells were stained for 15 min with 5 μM green fluorescent nucleic acid stain SYTO™ 9 (Invitrogen) at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... Nuclear stain: 4′,6′-diamidino-2-phenylindole dihydrochloride (DAPI, blue; 2 ng ml−1; Molecular Probes, USA). Sections were cover-slipped using ProLong Gold anti-fade reagent (Invitrogen ...
-
bioRxiv - Biophysics 2023Quote: ... Cell nuclei were stained with 4’,6’-diamidino-2-phenylindole dihydrochloride (DAPI; 2 ng/ml; Molecular Probes). Stained sections were imaged using epifluorescence and deconvolution epifluorescence microscopy on an Olympus IX83 ...
-
bioRxiv - Biophysics 2021Quote: ... Then the enzyme-inhibitor mixture was placed in a 6–8 kDa MWCO dialysis membrane (Fisher Scientific, Canada) and dialyzed against 2 L of 50 mM Tris-HCl ...
-
bioRxiv - Genomics 2021Quote: ... hiPSC-IMR90-1 cells were cultured on a Matrigel-coated 6-well plate with Essential 8 medium (Gibco). The medium was changed daily ...
-
bioRxiv - Cell Biology 2020Quote: ... 1.8 mM CaCl2, 6 mM NaHCO3, 5.5 mM D-glucose, 25 mM HEPES, pH 7.4 supplemented with Gibco MEM Amino Acids and MEM Non-Essential Amino Acids solution ...
-
bioRxiv - Neuroscience 2022Quote: ... mice were sacrificed 6-8 days after the last CDSD session and RNA was extracted with TriReagent (Ambion). Sequencing libraries were prepared with ScriptSeq v2 RNA-seq library preparation kit (Epicentre ...
-
bioRxiv - Bioengineering 2024Quote: ... RC Dialysis tubing (3.5 kDa or 8 kDa molecular weight cut-off, Spectrum Spectra/Por 6, Fisher Scientific), HCl (2M ...
-
bioRxiv - Developmental Biology 2023Quote: ... were isolated from embryos incubated for between 6 (E6.0) and 8 (E8.0) days and maintained in chilled Leibovitz’s L-15 media (GIBCO, Invitrogen). Papillae were dissected as described previously 65 and cultured nerve-side-down on Millicell cell culture inserts (Millipore ®) ...
-
bioRxiv - Biophysics 2021Quote: ... Secondary antibodies were goat anti-mouse-Star red (Abberior, 2-0002-011-2) and goat anti-rabbit Star 580 (Abberior 2-0012-0050-8) (Life Technologies, 1:100).
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Cell Biology 2019Quote: ... 5 and 8 were dissociated into single cells with 0.05% Trypsin-EDTA (Invitrogen, 25300062), counted by Countstar (BioTech ...
-
bioRxiv - Microbiology 2022Quote: Total RNA from pools of 5 to 8 mosquitoes was isolated with TRIzol (Invitrogen). Small RNAs of 19-33 nucleotides in length were purified from a 15% acrylamide/bisacrylamide (37.5:1) ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... or 10 mM 2’,7’-dichlorodihydrofluorescein diacetate (DCFH-DA, Thermo Fisher Scientific, Waltham, MA, USA). The cells stained with TMRE or NAO were incubated for 15 minutes at 37◦C whereas cells stained with HE and DCFH-DA were incubated for 30 minutes at 37◦C in the dark ...
-
bioRxiv - Immunology 2022Quote: ... The cells were incubated in presence of 2’,7’-dichlorodihydrofluorescein diacetate (H2DCFDA, 25 mM) (Invitrogen) for 30min at 37 °C and 5% of CO2 ...
-
bioRxiv - Microbiology 2021Quote: ... or with 2 µM CellEvent™ Caspase-3/7 Green Detection Reagent (Thermo Fisher Scientific) for 30 min at room temperature (1:150 in AnnexinV binding buffer-Biolegend) ...
-
bioRxiv - Microbiology 2021Quote: ... was assessed by the cell-permeant 2′,7′-dichlorodihydrofluorescein diacetate (CFDA) (10 µg/ml, ThermoFisher) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were stained with 2 μM propidium iodide (PI) and 7 μM Hoechst 33342 (ThermoFisher) for 5-10 min and imaged under a Zeiss Observer Z1 microscope ...
-
bioRxiv - Physiology 2023Quote: ... followed by 7 days of decalcification with Shandon’s TBD-2 (Thermo Scientific, Waltham, MA, USA) at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... SuperSignal Chemiluminescent substrate and 2’,7’-dichlorodihydrofluorescein diacetate acetyl ester (H2DCFDA) were from Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cellular reactive oxygen species (ROS) levels were detected using 2’,7’ dichlorodihydrofluorescein diacetate (H2DCFDA; Invitrogen). Cells were treated in the absence or presence of drugs for 48 hours ...
-
bioRxiv - Bioengineering 2022Quote: ... Spheroid viability was evaluated at days 1 and 7 via Calcein AM (Invitrogen, 2 µM) and ethidium homodimer (Invitrogen ...
-
bioRxiv - Neuroscience 2024Quote: Intracellular ROS in BV-2 cells was measured by incubating cells with 1 µM cell-permeant 2’,7’-dichlorodihydrofluorescein diacetate (H2DCFDA, Invitrogen, D399) at 37°C for 30 min.
-
bioRxiv - Immunology 2023Quote: ... cells were stained at 37°C for 30 min with 2 µM 2’,7’-dichlorodihydrofluorescein diacetate (H2DCF-DA; Thermo Fisher Scientific) or 1 µM MitoSOX (Thermo Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2021Quote: ... was cultured at 2-8×105 cells/ml in Fischer’s medium with 20% horse serum and 2 mM L-glutamine (all Gibco).
-
bioRxiv - Neuroscience 2021Quote: ... 8% SDS and 2% β-mercaptoethanol) were loaded onto 12% SDS-polyacrylamide gel and See-Plus 2 (Invitrogen, LC5925) was used as a molecular-weight marker ...