Labshake search
Citations for Thermo Fisher :
801 - 850 of 10000+ citations for 7H Benzocyclohepten 7 one 2 amino 5 6 8 9 tetrahydro 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... 1% nonessential amino acids (1140050) and 50μM 2-mercaptoethanol (31350-010) (all Thermo Fisher Scientific unless specified), 1,000 U/ml LIF (ESGRO ESG1107 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were maintained in RF10: RPMI 1640 supplemented with 2 mM MEM nonessential amino acid solution (Gibco), 100 mM HEPES (Gibco) ...
-
bioRxiv - Systems Biology 2023Quote: ... 0.1 mM CaCl2 and either 10% Luria Broth (Figs 1&2) or MEM amino acids (from Gibco) (Figs 3–5) ...
-
bioRxiv - Molecular Biology 2023Quote: ... MMP-2 and −9 activity was determined using gelatine containing zymography gels (Thermo Fisher Scientific, Karlsbad, CA, USA) as previously described (37).
-
bioRxiv - Cell Biology 2020Quote: ... Sequencing was performed using Ion Proton instrument with 7 or 8 samples per chip with Ion PI Hi-Q Sequencing 200 Kit (ThermoFisher Scientific). Reads were aligned to the hg19 AmpliSeq Transcriptome ERCC v1 with Torrent Mapping Alignment Program (version 5.0.4 ...
-
bioRxiv - Biophysics 2023Quote: ... the media was removed and the cells were incubated with 8 µM CellEventTM Caspase 3-7 green detection reagent (Thermo Fisher) in PBS containing 5% FBS for 30 min at 37 °C ...
-
bioRxiv - Cancer Biology 2021Quote: ... carrying the mutation R273C was first amplified by PCR using the primers hp53-1 (5’-CACCATGGAGGAGCCGCAGTCAGATCC-3’) and hp53-8 (5’-GGATCCTCAGTCTGAGTCAGGCCCTTCTGTCTTG-3’) and cloned into the pENTR/D-TOPO vector (ThermoFisher) generating the entry vector pENTR p53(R273C ...
-
bioRxiv - Cancer Biology 2019Quote: ... was cultured in RPMI with 5 % heat inactivated human serum (HS) and 2 ng/mL interleukin (IL)-6 (Gibco, Thermo Fisher Scientific, Waltham, MA, USA). In vitro experiments with KJON cells were performed with 2 % HS in RPMI and IL-6 (1 ng/mL) ...
-
bioRxiv - Cell Biology 2021Quote: ... dried peptide sample was resuspended in 200 mM HEPES (pH 8) and incubated for 1 h at room temperature with one of the TMT10-plex reagents (ThermoFisher) solubilized in 100% anhydrous ACN ...
-
bioRxiv - Immunology 2022Quote: ... 8-16 barcoded samples were pooled and loaded on one Ion 530 chip using the Ion Chef Instrument (ThermoFisher Scientific) and sequenced on the Ion S5 System with 550 flows.
-
The RNA-binding protein RbpB is a central regulator of polysaccharide utilization in gut BacteroidesbioRxiv - Microbiology 2023Quote: ... The alkaline hydrolysis ladder was prepared by incubating 0.4 pmol 5’ end-32P-labeled RNA in 9 µL of 1x alkaline hydrolysis buffer (Ambion) for 5 min at 95°C ...
-
bioRxiv - Neuroscience 2023Quote: ... Nuclear stain: 4′,6′-diamidino-2-phenylindole dihydrochloride (DAPI, blue; 2 ng ml−1; Molecular Probes, USA). Sections were cover-slipped using ProLong Gold anti-fade reagent (Invitrogen ...
-
bioRxiv - Biophysics 2023Quote: ... Cell nuclei were stained with 4’,6’-diamidino-2-phenylindole dihydrochloride (DAPI; 2 ng/ml; Molecular Probes). Stained sections were imaged using epifluorescence and deconvolution epifluorescence microscopy on an Olympus IX83 ...
-
bioRxiv - Biophysics 2021Quote: ... Then the enzyme-inhibitor mixture was placed in a 6–8 kDa MWCO dialysis membrane (Fisher Scientific, Canada) and dialyzed against 2 L of 50 mM Tris-HCl ...
-
bioRxiv - Genomics 2021Quote: ... hiPSC-IMR90-1 cells were cultured on a Matrigel-coated 6-well plate with Essential 8 medium (Gibco). The medium was changed daily ...
-
bioRxiv - Cell Biology 2020Quote: ... 1.8 mM CaCl2, 6 mM NaHCO3, 5.5 mM D-glucose, 25 mM HEPES, pH 7.4 supplemented with Gibco MEM Amino Acids and MEM Non-Essential Amino Acids solution ...
-
bioRxiv - Neuroscience 2022Quote: ... mice were sacrificed 6-8 days after the last CDSD session and RNA was extracted with TriReagent (Ambion). Sequencing libraries were prepared with ScriptSeq v2 RNA-seq library preparation kit (Epicentre ...
-
bioRxiv - Developmental Biology 2023Quote: ... were isolated from embryos incubated for between 6 (E6.0) and 8 (E8.0) days and maintained in chilled Leibovitz’s L-15 media (GIBCO, Invitrogen). Papillae were dissected as described previously 65 and cultured nerve-side-down on Millicell cell culture inserts (Millipore ®) ...
-
bioRxiv - Bioengineering 2024Quote: ... RC Dialysis tubing (3.5 kDa or 8 kDa molecular weight cut-off, Spectrum Spectra/Por 6, Fisher Scientific), HCl (2M ...
-
bioRxiv - Biophysics 2021Quote: ... Secondary antibodies were goat anti-mouse-Star red (Abberior, 2-0002-011-2) and goat anti-rabbit Star 580 (Abberior 2-0012-0050-8) (Life Technologies, 1:100).
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Cell Biology 2019Quote: ... 5 and 8 were dissociated into single cells with 0.05% Trypsin-EDTA (Invitrogen, 25300062), counted by Countstar (BioTech ...
-
bioRxiv - Microbiology 2022Quote: Total RNA from pools of 5 to 8 mosquitoes was isolated with TRIzol (Invitrogen). Small RNAs of 19-33 nucleotides in length were purified from a 15% acrylamide/bisacrylamide (37.5:1) ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... or 10 mM 2’,7’-dichlorodihydrofluorescein diacetate (DCFH-DA, Thermo Fisher Scientific, Waltham, MA, USA). The cells stained with TMRE or NAO were incubated for 15 minutes at 37◦C whereas cells stained with HE and DCFH-DA were incubated for 30 minutes at 37◦C in the dark ...
-
bioRxiv - Immunology 2022Quote: ... The cells were incubated in presence of 2’,7’-dichlorodihydrofluorescein diacetate (H2DCFDA, 25 mM) (Invitrogen) for 30min at 37 °C and 5% of CO2 ...
-
bioRxiv - Microbiology 2021Quote: ... or with 2 µM CellEvent™ Caspase-3/7 Green Detection Reagent (Thermo Fisher Scientific) for 30 min at room temperature (1:150 in AnnexinV binding buffer-Biolegend) ...
-
bioRxiv - Microbiology 2021Quote: ... was assessed by the cell-permeant 2′,7′-dichlorodihydrofluorescein diacetate (CFDA) (10 µg/ml, ThermoFisher) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were stained with 2 μM propidium iodide (PI) and 7 μM Hoechst 33342 (ThermoFisher) for 5-10 min and imaged under a Zeiss Observer Z1 microscope ...
-
bioRxiv - Physiology 2023Quote: ... followed by 7 days of decalcification with Shandon’s TBD-2 (Thermo Scientific, Waltham, MA, USA) at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... SuperSignal Chemiluminescent substrate and 2’,7’-dichlorodihydrofluorescein diacetate acetyl ester (H2DCFDA) were from Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cellular reactive oxygen species (ROS) levels were detected using 2’,7’ dichlorodihydrofluorescein diacetate (H2DCFDA; Invitrogen). Cells were treated in the absence or presence of drugs for 48 hours ...
-
bioRxiv - Bioengineering 2022Quote: ... Spheroid viability was evaluated at days 1 and 7 via Calcein AM (Invitrogen, 2 µM) and ethidium homodimer (Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... cells were stained at 37°C for 30 min with 2 µM 2’,7’-dichlorodihydrofluorescein diacetate (H2DCF-DA; Thermo Fisher Scientific) or 1 µM MitoSOX (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2024Quote: Intracellular ROS in BV-2 cells was measured by incubating cells with 1 µM cell-permeant 2’,7’-dichlorodihydrofluorescein diacetate (H2DCFDA, Invitrogen, D399) at 37°C for 30 min.
-
bioRxiv - Developmental Biology 2021Quote: ... was cultured at 2-8×105 cells/ml in Fischer’s medium with 20% horse serum and 2 mM L-glutamine (all Gibco).
-
bioRxiv - Neuroscience 2021Quote: ... 8% SDS and 2% β-mercaptoethanol) were loaded onto 12% SDS-polyacrylamide gel and See-Plus 2 (Invitrogen, LC5925) was used as a molecular-weight marker ...
-
bioRxiv - Cell Biology 2020Quote: ... Quantitative real-time PCR was run on a ViiA 7 or QuantStudio 6 Flex PCR thermal cycler (Thermo Fisher Scientific) using SensiMix™ SYBR® No-ROX Kit (Bioline ...
-
CHC22 clathrin mediates traffic from early secretory compartments for human GLUT4 pathway biogenesisbioRxiv - Cell Biology 2019Quote: ... Differentiation of confluent hSkMC-AB1190 myoblasts and hSkMC-AB1190-GLUT4 myoblasts was induced by incubating the cells in differentiation medium for 6 to 7 days: DMEM (Gibco), Gentamycin 50 µg/ml (Gibco ...
-
bioRxiv - Neuroscience 2020Quote: ... of 0.5% low-melting agarose (FMC; Pignata et al., 2019) containing a 6:7 ratio of spinal cord medium (MEM with Glutamax (Gibco) supplemented with 4 mg/ml Albumax (Gibco) ...
-
bioRxiv - Neuroscience 2020Quote: ... 100-µl drop of 0.5% low-melting agarose (FMC, Fig. 1D,E, Fig. S1G) containing a 6:7 ratio of spinal cord medium [MEM with Glutamax (Gibco) supplemented with 4 mg/ml Albumax (Gibco) ...
-
Highly efficient homology-directed repair using transient CRISPR/Cpf1-geminiviral replicon in tomatobioRxiv - Molecular Biology 2019Quote: ... 2015) (Supplemental Table 6 and 7) junctions and a high-fidelity Taq DNA polymerase (Phusion Taq, Thermo Fisher Scientific, USA) and Sanger sequencing (Solgent ...
-
bioRxiv - Physiology 2023Quote: ... at 1,000g for 2min and then immediately loaded into the QuantStudio 6 and 7 Flex real-time PCR system (ThermoFisher Scientific). A two-step cycling protocol was implemented to collect cycle threshold (Ct ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were then washed and stained for 20 min at 4 °C with the following antibodies: anti-mouse CD8α APC-efluo780 (clone 53-6-7, ebioscience/ Thermofisher), anti-mouse CD8β AF700 or BUV495 (clone YTS156 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3.6 x 106 HEK293T17 cells were transfected on a 6-well plate with 7 µl Lipofectamine 3000 (Thermo Fisher Scientific), the packaging plasmids psPax2 (3 µg ...
-
bioRxiv - Cancer Biology 2023Quote: ... following manufacturer’s protocols and gene expression quantified via Applied Biosystems Quant Studio 6/7 Real-Time PCR System (Applied Biosystems), for TaqMan (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... BHK-21 cells (7×105/well) were transfected in tissue culture-treated 6-well plates using Lipofectamine 2000 (ThermoFisher Scientific) with the LCMV Arm plasmids pCAGGS-NP (0.8 µg) ...
-
bioRxiv - Cell Biology 2022Quote: ... we used 7-AAD (7-Aminoactinomycin D) (Thermofisher, # A1310) or FxCycle™ PI/RNase Staining Solution (Thermofisher ...
-
bioRxiv - Genomics 2020Quote: ... 7-Aminoactinomycin D (7-AAD) (1:200 dilution, ThermoFisher Scientific #A1310 ...
-
bioRxiv - Neuroscience 2022Quote: ... 7-aminoactinomycin D (7-AAD, Thermo Fisher, A 1310) was added 1:50 as a cell death marker.
-
bioRxiv - Neuroscience 2023Quote: ... At 5-6 dpf each FoxP2.A:FingR(PSD95)+ larva was placed into individual wells of a 6-well plate (Thermo Fisher Scientific) containing approximately 10mL of fish water ...