Labshake search
Citations for Thermo Fisher :
751 - 800 of 10000+ citations for 7H Benzocyclohepten 7 one 2 amino 5 6 8 9 tetrahydro 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2020Quote: ... and subsequently 4′,6-diamidino-2-phenylindole (DAPI) (Invitrogen, 1:50000) for 20 minutes ...
-
bioRxiv - Systems Biology 2021Quote: ... and counterstained with 4′,6-diamidino-2-phenylindole (DAPI) (Life Technologies) following the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... blotted for 2-6 s in a VitroBot (Mark IV, ThermoFisher) at 4 °C and 100% humidity ...
-
bioRxiv - Immunology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific, Waltham, MA, USA) staining solution and mounted with cover glass ...
-
bioRxiv - Microbiology 2022Quote: ... and 4’,6-diamidino-2-phenylindole counterstain (DAPI, Thermo Fisher Scientific) in antibody buffer at room temperature for one hour ...
-
bioRxiv - Microbiology 2022Quote: ... and mounted with ProLong Diamond + 4’,6-diamidino-2-phenylindole (Invitrogen). Imaging was performed on a Zeiss 880 laser scanning confocal microscope ...
-
bioRxiv - Microbiology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) antifade reagent (Life Technologies, CA, USA) and sealed with nail polish.
-
bioRxiv - Pathology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific, Waltham, MA, USA), mounted ...
-
bioRxiv - Pathology 2023Quote: ... 6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific, Waltham, MA, USA), mounted ...
-
bioRxiv - Cell Biology 2023Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, 1:50000 dilution, Molecular Probes) was treated in the cells for 3min ...
-
bioRxiv - Bioengineering 2023Quote: ... together with 4′,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific) diluted in 2% BSA in PBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen, #D1306, 1/1000) were incubated overnight at 4°C in the dark ...
-
bioRxiv - Physiology 2023Quote: ... DAPI (4’,6-diamidino-2-phenylindole) (D1306) was purchased from Invitrogen. XMU-MP1 (#22083 ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306) was used to stain the DNA content of cells so that doublets and debris could be removed by sorting on the DAPI height vs DAPI area ...
-
bioRxiv - Microbiology 2024Quote: ... 4’,6’-diamino-2-fenil-indol (DAPI) (1:25000, Life Technologies) and Phalloidin (Alexa 488 ...
-
bioRxiv - Bioengineering 2023Quote: ... The 4′,6-diamidino-2-phenylindole (DAPI) was acquired from Invitrogen, Thermofisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... counterstaining with 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) or propidium iodide (PI ...
-
bioRxiv - Physiology 2019Quote: Total RNA samples were extracted from one thousand 4-7 day-old Culex female antennae with TRIzol reagent (Invitrogen, Carlsbad, CA). Antennal cDNA was synthesized from 1 µg of antennal total RNA from each species using iScript cDNA synthesis kit (Bio-Rad ...
-
bioRxiv - Bioengineering 2024Quote: ... subsequently buffer exchanged by using 7 K MWCO Zeba Spin Desalting Columns and the concentration was measured by Nanodrop One (Thermofisher Scientific).
-
bioRxiv - Immunology 2021Quote: C-LP cells pooled from 5-7 mice were sorted into TriZol® (Thermo Fisher) and cDNA was generated by using QuantiTect Reverse Transcription Kit (Qiagen) ...
-
bioRxiv - Biochemistry 2021Quote: ... 5-7 μg BACMID DNA was incubated with 4 μL Fugene (Thermo Fisher, Cat# 10362100) in 200 μL of ESF 921 media for 30 minutes at 23°C ...
-
bioRxiv - Neuroscience 2024Quote: ... Cultures were passaged as aggregates every 5-7 days using a collagenase IV solution (Gibco) to detach hESC colonies ...
-
bioRxiv - Developmental Biology 2024Quote: ... PCR was performed with Scientific QuantStudio 5 and 7 Real-Time PCR System (Thermo Fisher) using the DyNAmo Color Flash SYBR Green Mix (Thermo Fisher) ...
-
bioRxiv - Neuroscience 2024Quote: ... Cells were passaged once every 5-7 days using 0.5 mM EDTA (Life Technologies, #AM9260G) in phosphate-buffered saline (PBS)-/- (Life Technologies ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were passaged once every 5-7 days using 0.5 mM EDTA (Life Technologies, #AM9260G) in PBS-/- (Life Technologies ...
-
bioRxiv - Immunology 2021Quote: ... 2020) and reactions were carried out using a QuantStudio 6 and 7 Flex Real-Time PCR system (Applied Biosystems) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: One hundred and fifty tergal gland segments (Segment 7) and control segments (Segment 6) of Dalotia males were dissected in EBSS (Earle’s Balanced Salt Solution; ThermoFisher) and transferred to into 150 µl ice-cold Schneider’s Drosophila medium and fetal bovine serum (SDM+FBS ...
-
bioRxiv - Developmental Biology 2022Quote: ... hiPSC at day 6-7 after passaging were treated with a 1:1 mixture of TrypLE Select (Life Technologies) and 0.5 mM EDTA/phosphate-buffered saline (PBS ...
-
bioRxiv - Neuroscience 2022Quote: ... of 0.5% low-melting agarose (FMC) containing a 6:7 ratio of spinal cord medium (MEM with Glutamax (Gibco) supplemented with 4 mg/ml Albumax (Gibco) ...
-
Vitamin D signaling orchestrates skeletal muscle metabolic flexibility by regulating its fuel choicebioRxiv - Physiology 2023Quote: ... Quantitative RT– PCR was performed using the QuantStudio-6 and -7 Flex Real-Time PCR Systems (Thermo Fisher Scientific) with SYBR® Premix Ex Taq (Tli RNase H Plus ...
-
bioRxiv - Immunology 2022Quote: ... All samples were prepared in triplicate and run on a QuantStudio 6/7 Flex Real-Time PCR System (ThermoFisher). Primer sequences for designated HHV-6 marker (U31 ...
-
bioRxiv - Cancer Biology 2023Quote: ... normalized to the expression of GAPDH on a QuantStudio 6 and 7 Pro real-time PCR system (Applied Biosystems).
-
bioRxiv - Cell Biology 2023Quote: ... Results were analyzed with the Design and Analysis Software QuantStudio 6/7 Pro systems (Thermo Fisher Scientific, version 2.6). Primers 20-23,36-39 (Supplementary Methods Table 2 ...
-
bioRxiv - Cell Biology 2023Quote: ... Results were analyzed with the Design and Analysis Software QuantStudio 6/7 Pro systems (Thermo Fisher Scientific, version 2.6). Primers 20-59 (Supplementary Methods Table 2 ...
-
bioRxiv - Biochemistry 2022Quote: ... Cells were pelleted one last time at 400 x g for 5 min and resuspended into 5 ml of PBS (GIBCO) supplemented with protease inhibitors (ThermoFischer Scientific) ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Cell Biology 2022Quote: ... and 7-AAD (7-Aminoactinomycin D) (Thermofisher, # A1310) was used for DNA staining ...
-
bioRxiv - Genomics 2019Quote: ... To one portion 10 µL T4 DNA ligase (5 Weiss U/µL, Thermo Scientific) was added ...
-
bioRxiv - Cancer Biology 2023Quote: ... and one wash with 50 μl of 5× Maxima H RT buffer (Thermo Fisher). Finally ...
-
bioRxiv - Neuroscience 2020Quote: ... 5-ethynyl-2’-deoxyuridine (EdU; 5 mg per kg body weight, Invitrogen) dissolved in sterile phosphate buffer solution (PBS ...
-
bioRxiv - Microbiology 2023Quote: ... 5-[3-aminoallyl]-2’-deoxyuridine-5’-triphosphate (aminoallyl-dUTP, Thermo Scientific™) was incorporated into a PCR by the use of a DreamTaqTM DNA Polymerase (Thermo Scientific™ ...
-
bioRxiv - Cell Biology 2021Quote: ... Cell pellets were then resuspended and plated into one well of a 6 well plate (Fisher Scientific 1483211). Cells were left to sit for 5 days at 37°C and 5% CO2 after initial plating and were only fed once after three days by adding an additional volume of FCM ...
-
bioRxiv - Neuroscience 2023Quote: ... EBs were seeded on one well of a 6-well plate coated with poly-Ornithine/Laminin (Thermo Scientific). Medium was changed every other day ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were passaged every 5 or 6 days using Versene (Gibco, A4239101). Clinical hESCs were tested weekly for mycoplasma contamination using a Myco-detection Kit (InvivoGen ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 Bcl6 and 6 Smyd2 KO livers using TRIzol reagent (Invitrogen #15596026) followed by purification using the RNeasy Mini kit (Qiagen #74014) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... С6 and CHO/5-HT2C were maintained in the F12 medium (Invitrogen). In all cases ...
-
bioRxiv - Bioengineering 2024Quote: ... Coupling 5-(and 6)-Carboxytetramethylrhodamine (TAMRA) mixed isomers (Thermo Scientific, Waltham, MA) and Fmoc-8-amino-3,6-dioxaoctanoic acid (Fmoc-PEG2-OH ...
-
bioRxiv - Cancer Biology 2019Quote: ... 4 mM serine and essential amino acids (MEM Amino Acids Solution; Gibco, 11130036); for all other experiments ...
-
bioRxiv - Cell Biology 2023Quote: ... 9 µL of the reaction was stopped with 9 µL NuPAGE LDS Sample Buffer (Invitrogen) at 0 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... we used 20 amino acids that contained 2 mM of 13C6 15N2 L-lysine (Thermo Fisher Scientific) and 13C6 15N4 L-arginine (Thermo Fisher Scientific ...