Labshake search
Citations for Thermo Fisher :
8901 - 8950 of 10000+ citations for TRAP 5 amide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... OH ladders were generated by 5 min of incubation of 0.2 pmol of labeled RNA in alkaline hydrolysis buffer (Ambion) at 95°C ...
-
bioRxiv - Microbiology 2020Quote: ... and probe E_Sarbeco_P1 (5′-FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ-3′) using the TaqPath 1-Step Multiplex Master Mix kit (Applied Biosystems) on a QuantStudio 5 real-time PCR system (Appiled Biosystems) ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were heated 5 min at 65°C and loaded onto a Novex Wedgewell 12% Tris-glycine gel (Invitrogen). Each sample was loaded on two different wells and protein’s migration was then performed according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... and SK-N-SH cell lines were purchased from the American Type Culture Collection (www.atcc.org) and grown in a humidified chamber with 5% CO2 in RPMI 1640 medium (Gibco, #11875119) supplemented with 10% fetal bovine serum (FBS) ...
-
bioRxiv - Cancer Biology 2021Quote: ... MCF10A (CRL-10317) cells were cultured in DMEM /F12 Ham’s Mixture supplemented with 5% Equine Serum (Thermofisher Catalog # 16050130), EGF 20 ng/ml (Sigma) ...
-
bioRxiv - Molecular Biology 2020Quote: ... at a concentration of 5 μg/cm2 following surface activation of the glass slide with sulfo-SANPAH (Thermo Scientific). Cells were cultured on the gels or glass slides and placed in a microfluidic chamber (Bioptechs Inc. ...
-
bioRxiv - Cell Biology 2019Quote: ... This solution was passed through a 70 μm cell strainer into 5 mL of a growth media comprised of Ham’s F12 (Gibco), 20% FBS ...
-
bioRxiv - Cell Biology 2020Quote: ... the cells were washed with PBS and were first incubated for 5 min at room temperature with RNase A (0.2 mg/ml; Invitrogen), followed by a 15 min incubation at 37°C with propidium iodide (PI ...
-
bioRxiv - Cell Biology 2020Quote: Freshly ejaculated duck sperm were incubated for 20 min with mitochondrial potential dye Mitotracker-Red (5 μM; Life Technologies) at 37 °C and then fixed with 1:1 ratio (v/v ...
-
bioRxiv - Cell Biology 2020Quote: ... Supernatant (1 ml at ~4-5 mg/ml) was incubated with 50 μl of superparamagnetic Dynabeads Streptavidin C1 (Invitrogen) and rotated overnight at 4 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... For plasma membrane staining with 5 μg/mL Alexa Fluor 350/tetramethylrhodamine conjugated to Wheat Germ Agglutinin (WGA) (Invitrogen), cells were fixed and washed with PBS before application for 10 min at RT ...
-
bioRxiv - Cell Biology 2020Quote: ... and sorted into Ham’s F-10 plating medium (Cellgro) supplemented with 5 ng/mL basic fibroblast growth factor (Invitrogen), 10% FBS (Invitrogen) ...
-
bioRxiv - Cell Biology 2020Quote: ... then loaded with 2’,7’-bis-(2-carboxyethyl)-5-(and-6)-carboxyfluorescein acetoxymethylester (BCECF-AM, 1.6 μM, Life Technologies) for 30 min at 37°C ...
-
bioRxiv - Cell Biology 2020Quote: ... Samples were washed for 4 x 5 min in PBS and mounted in Prolong Gold with DAPI stain (Invitrogen). Imaging was performed on an Axio Observer microscope (Zeiss ...
-
bioRxiv - Cell Biology 2020Quote: ... Melanoma cell line 501mel was grown in 5% CO2 at 37°C in RPMI w/o HEPES (Gibco, Invitrogen) supplemented with 10% FCS and Gentamycin ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were incubated with 40 nM siRNA and 4μL for CPT1A KD and 5 μL for DRP1 KD RNAiMAX in OptiMEM (Gibco) for 4–5 hours ...
-
bioRxiv - Immunology 2021Quote: ... were cotransfected with pcΔ19S and 5 μg pSCTZ-alpha N85 or variable amounts of pLenti.ACE2-HA and 5 μg of pSCTZ-omega by lipofection with lipofectamine 2000 (Invitrogen). After 24 hours ...
-
bioRxiv - Immunology 2021Quote: ... macrophages were preincubated for 5 min at 37 °C with 2.5 µM of Yo-Pro-1 iodide (Life Technologies) after galvanic current application or 1% triton X100 (Sigma-Aldrich ...
-
bioRxiv - Immunology 2021Quote: ... The pool was incubated with biotinylated SARS CoV2 Spike extracellular domain bound to 5 μL streptavidin M280 dynabeads (ThermoFisher) for 1 hour at room temperature ...
-
bioRxiv - Genetics 2021Quote: ... A second DNase treatment was performed on the purified RNA using 5 μL of Turbo DNase (Life Technologies, AM2238) with buffer ...
-
bioRxiv - Developmental Biology 2021Quote: ... guide RNA for RBPMS2 (sequence 5’-GTCTTGCAGTGAGCTTGATC-3’) was synthesized using the T7 MegaShortScript transcription kit (Thermo Fisher Scientific). We previously described methods 28 to generate a doxycycline - inducible Cas9 line in the WTC-11 iPSC background (Coriell Institute) ...
-
bioRxiv - Molecular Biology 2020Quote: ... LL24 cells were grown at 37°C in a humidified atmosphere of 5% CO2 in RPMI-1640 medium (Gibco), supplemented with 10% FBS (Gibco ...
-
bioRxiv - Microbiology 2019Quote: ... Briefly, parasitized erythrocytes were resuspended in complete media (5% parasitemia, 4% hematocrit) and incubatedwith 1µM BODIPY-TR-ceramide (Invitrogen) at 37°C for 60 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... The fixed cells were washed with PBS and blocked with 5% goat serum for 1 hr (Thermo Fisher, 31872). Mouse anti-T7 primary antibody (Millipore Sigma ...
-
bioRxiv - Molecular Biology 2021Quote: ... 25 pmol of siRNA were mixed with 5 µL of Lipofectamine RNAiMAX in 500 µL of Opti-MEM (Invitrogen) in a 6-well plate ...
-
bioRxiv - Developmental Biology 2021Quote: Total RNA of E12.5 neural tube tissue was extracted using the Ambion Purelink RNA mini kit according to the manufacturer’s instructions (ThermoFisher). Invitrogen Purelink DNase (ThermoFisher ...
-
bioRxiv - Microbiology 2021Quote: ... for 14 days and validated by transfection with 5 µg Cre recombinase plasmid using LipofectamineP3000 (ThermoFisher Scinetific Waltham, MA). After 24h and 48h ...
-
bioRxiv - Microbiology 2021Quote: ... Radiolabeled RNA was incubated 5 min at 90°C with alkaline buffer or 5 min at 37°C with ribonuclease T1 (0.1 U; Ambion) to generate the Alkaline (OH ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... to the tube was added a solution of 0.269 mg of P58 mixed 5:1 by volume with salmon sperm DNA (Invitrogen), followed by 3 mL of 39.52% polyethylene glycol ...
-
bioRxiv - Developmental Biology 2020Quote: Cas9 mRNA/sgRNA injection solution was prepared to 5 mg/ml fluorescein-labeled dextrans (10,000 MW, Thermo Fisher Scientific), 20% glycerol ...
-
Planarian CREB-binding protein (CBP) gene family regulates stem cell maintenance and differentiationbioRxiv - Developmental Biology 2020Quote: ... total RNA was isolated from a pool of 5 treated planarians per condition by homogenization in TRIzol Reagent (Invitrogen). Housekeeping gene ura4 was used to normalize the expression levels.
-
bioRxiv - Microbiology 2021Quote: ... 20 µl resuspended parasite culture was incubated with dihydroethidium (5 µg/ml, Cayman) and SYBR Green I dye (0.25 x dilution, Invitrogen) in a final volume of 100 µl medium for 20 min at RT protected from light ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10 μL of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, concentration 5 mg/mL, Invitrogen, cat. M6494) in PBS was added to each well containing culture medium and incubated for 2.5 h at 37 °C ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 nM biotinylated 685-bp DNA fragment (68% AT; Table S2) coupled to 3 μL M280 streptavidin dynabeads (ThermoFisher) was incubated with 5 nM prey DNA and H-NS in supplemented Filament Buffer at 5–8 μM 6:4 WT H-NS ...
-
bioRxiv - Bioengineering 2022Quote: ... Membranes were probed overnight at 4 °C with primary antibodies diluted to 1/2000 in 5% BSA and 0.1% sodium azide in PBS using specific total MET (#37-0100 Invitrogen), total ERK2 (#SC-154 Tebu-bio) ...
-
bioRxiv - Cell Biology 2022Quote: ... 5×106 TIME cells (passages 14 to 21) were suspended in serum and antibiotic-free DMEM (ThermoFisher, Waltham, MA) and incubated with Halo-CD36 (1 μg ...
-
bioRxiv - Genomics 2022Quote: ... qPCR was performed with gene-specific primer probe fluorogenic exonuclease assays (TaqMan, Life Technologies, Waltham, MA, Supplemental table 5) and the QuantStudio 12K Flex Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2E05 cells of each cell line were resuspended in 200 μL of 5 μM solution of MitoSOX (Invitrogen, UK) prepared in N2B27 media ...
-
bioRxiv - Molecular Biology 2021Quote: ... samples were incubated with secondary antibodies conjugated to HRP at 1:20,000 in 5% milk/1x TBST for 1 hour (goat anti-mouse-HRP, 32430; ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were counterstained by 5 min incubation in 300 µM DAPI intermediate solution (1:1,000, Molecular Probes, Cat# B34650). Section were then washed with PBS three times ...
-
bioRxiv - Molecular Biology 2020Quote: ... 20 % PEG400) and 5’ end was phosphorylated by treating RNA with T4 Polynucleotide Kinase (1x PNK buffer (Thermo Scientific), 1mM ATP) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5µl of each peptide extracts were loaded onto 300 µm ID x 5 mm PepMap C18 precolumn (ThermoFisher, Dionex) at 20 µl/min in 2% acetonitrile ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were centrifugated (1000 RPM) and then resuspended in 5 mL of N2B27 with 0.1% of BSA (Life Technologies) and 0.1% of bFgf (PeproTech ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3.125 μM Oligo-dT30VN (IDT, 5’AGCAGTGGTATCAACGCAGAGTACT30VN-3’) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher, 4456740)) into 384-well hard-shell PCR plates (Biorad HSP3901 ...
-
bioRxiv - Cell Biology 2022Quote: ... The pieces were washed several times in PBS before replacing the solution with 5 ml PBS and 10 mM EDTA pH 8.0 (Invitrogen) and incubating the tissue pieces on ice for 15 minutes with intermittent shaking every 2 minutes ...
-
bioRxiv - Immunology 2022Quote: Small-intestine IELs were isolated as previously described [50] : Changes were made as follow: DTT (BP172-5, Fisher Scientific) was used instead of DTE ...
-
bioRxiv - Genomics 2020Quote: ... Cells were cultured at 37°C in a humidified incubator containing 5% CO2 and maintained in DMEM (Life Technologies) containing 10% FBS (Sigma-Aldrich ...
-
bioRxiv - Genomics 2020Quote: HEK293T cells were cultured at 37°C and 5% CO2 in complete medium (Dulbecco’s Modified Eagle Medium, Life Technologies) supplemented with 10% fetal bovine serum (OmegaScientific) ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were washed in phosphate-buffered saline (PBS) then resuspended in PBS containing 5 μg/mL propidium iodide (Invitrogen). A sample was boiled before resuspension in propidium iodide as a positive control and an unstained sample was used as the negative control ...
-
bioRxiv - Cancer Biology 2019Quote: ... human recombinant Epidermal Growth Factor 1-53 (EGF 1-53, 5 ng/ml, Thermo Fisher Scientific, catalog #17005-042) and 1% penicillin/streptomycin ...