Labshake search
Citations for Thermo Fisher :
8801 - 8850 of 10000+ citations for 6 Methyl 2 Mercaptobenzothiazole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: Zebrafish larvae (6 day-post-fertilization) were incubated in embryo medium with 1% DMSO and 5 mM EdU (Invitrogen C10340) for 8 hours at 29°C after the 16 hour Vc infection ...
-
bioRxiv - Genomics 2024Quote: ... the fibroblasts were thawed and plated at a density of 2.5×105 cells/well of 6-well plate and infected with the Cytotune Sendai virus (Life Technologies) per manufacturer’s protocol to initiate reprogramming ...
-
bioRxiv - Microbiology 2024Quote: Brachyspira pilosicoli strain P43/6/78 (ATCC #51139) was grown in Brain Heart Infusion (BHI) broth (Thermo Fisher Scientific, #CM1135B) containing 10% heat-inactivated fetal bovine serum and 0.2% glucose solution for four days in an anaerobic chamber (Coy Lab Products ...
-
bioRxiv - Molecular Biology 2024Quote: Total RNA was extracted from 10 to 20 ovaries from 3-6 day-old flies using TRizol (Thermo Fisher Scientific) following the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2023Quote: ... 2.5×105 Tet-mCherry-CENP-A HeLa-TRex cells were transfected with 1ug of either CENP-C-LAP or empty vector plasmid in 6-well plates with Lipofectamine 3000 (Invitrogen) according to manufacturer protocol ...
-
bioRxiv - Biochemistry 2024Quote: Hepa1-6 cells (mouse hepatoma; ATCC; CRL-1830) were cultured in high glucose DMEM containing 10% fetal bovine serum (FBS) (Gibco) and maintained at 37°C and 5% CO2 ...
-
bioRxiv - Cell Biology 2023Quote: ... in a QuantStudio 6 Flex Real-Time PCR System using QuantStudio Real-Time PCR Software (both Applied Biosystems, Waltham, MA). TaqMan probes used were ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA was synthetized from 2ug of total RNA using MMLV-Reverse transcriptase and d(N)6 random primers in a 20ul reaction following the manufacturer’s protocol (ThermoFisher Scientific). RT-qPCR analyses were performed in triplicate using 2.5 μl of cDNA ...
-
bioRxiv - Neuroscience 2024Quote: ... at 6 DIV with a total of 500ng DNA and 1.0 μl Lipofectamine 2000 reagent per well (11668019; ThermoFisher Scientific) in Opti-MEM reduced serum medium (31985062 ...
-
bioRxiv - Neuroscience 2024Quote: ... The slices were finally placed on 0.4 mm PTFE cell culture inserts (Millicell) equilibrated in a 6-well plate with serum-free media containing 1x B27 supplement (Gibco), 1x N2 supplement (Gibco) ...
-
bioRxiv - Molecular Biology 2024Quote: ... reverse: CCAGTTGGTAACAATGCCATGT) was tested as SYBR assays using QuantStudio 6 Flex RealTime PCR reader (RRID:SCR_020239, Thermo Fisher Scientific, Waltham, USA). Afterwards ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 µg of plasmid was used to transfect 750,000 cells in each well of a 6-well plate using Lipofectamine 2000 (5 µL; Thermo Fisher) in OptiMEM (400 µL ...
-
bioRxiv - Immunology 2024Quote: ... The amount of TNF-α and IL-6 in serum was quantified using commercial mouse ELISA kits (Thermo Fisher Scientific). For ex vivo experiments using splenic myeloid cells ...
-
bioRxiv - Cancer Biology 2024Quote: ... and DU145 cells were plated at 500 K cells per well on 6-well plates (Thermo Scientific™, Cat# 140675) coated with 10 µg/mL poly-D-lysine (PDL ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA for PCR amplification was obtained by reverse transcription of RNA extracted from 6 dpf embryos with TRIzol (15596026, Invitrogen) using the QuantiTect Reverse Transcription kit (205311 ...
-
bioRxiv - Cell Biology 2024Quote: ... DNA was again purified as above and a ligation reaction between 1:6 ratio of backbone:vector was carried out with T4 DNA ligase (Invitrogen, 15224017). Ligation mixture was incubated at 10 ...
-
bioRxiv - Immunology 2024Quote: ... We performed reaction in triplicates with 10 µl total volume using QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems). We normalized qPCR signal from ChIP DNA by 2% DNA input using the formula % of input = 100*2ᶺ(Ct [input]-Log2(50 ...
-
bioRxiv - Immunology 2024Quote: ... BHK-21 cells (7×105/well) were transfected in tissue culture-treated 6-well plates using Lipofectamine 2000 (ThermoFisher Scientific) with the LCMV Arm plasmids pCAGGS-NP (0.8 µg) ...
-
bioRxiv - Neuroscience 2023Quote: One million cortical cells and one million striatal cells were suspended in 6 mL D-minimum essential medium (DMEM, GIBCO) with 10% foetal bovine serum (DMEM+) ...
-
bioRxiv - Biochemistry 2024Quote: ... plasmid DNA into 1 × 106 HEK293 cells plated per well of a 6-well plate using Lipofectamine 2000 transfection reagent (Invitrogen). Each well was transfected with 2 µg of total plasmid DNA (50 ng Cg4-puro ...
-
bioRxiv - Biochemistry 2024Quote: ... fowleri trophozoites were grown to near 100% confluency in 6-well TC-treated plates (Thermo Scientific Nunclon Delta Surface 140685). HEX (25 µM ...
-
bioRxiv - Biochemistry 2024Quote: Bacmids containing 6×His-MBP-TEV-nsp12 variants were generated using the Bac-to-Bac™ baculovirus expression system (Invitrogen). Sf9 cells were transfected with the bacmid DNA and baculovirus-containing cell supernatants were harvested 5 days after transfection ...
-
bioRxiv - Biochemistry 2024Quote: ... Reactions were performed at 30°C for 10 min and terminated by addition of 0.4% SDS and 6 × loading buffer (Thermo Scientific). The reaction mixture was loaded onto an 0.8% agarose gel in 1x TAE (40 mM Tris ...
-
bioRxiv - Biochemistry 2024Quote: ... the cDNA fragments in pENTR-D-TOPO were transferred to the modified pHAGE plasmids (6) using LR recombination (Invitrogen 56484).
-
bioRxiv - Cancer Biology 2024Quote: 2×106 cells were seeded in 6 well plates and were incubated 24 hours later with 1uM of CellTrace Violet reagent (ThermoFisher) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: Protein concentrations of samples (fractions 6-9) were determined with a Pierce™ BCA Protein Assay Kit (ThermoFisher, Rockford, USA), and Bradford assay (Biorad ...
-
bioRxiv - Bioengineering 2023Quote: ... Transfer to a nitrocellulose membrane was done using 25 V for 6 min in the iBlot2 Gel Transfer device (IB21001, ThermoFisher). Then ...
-
bioRxiv - Cell Biology 2023Quote: ... the NPC line used is designated MGH2046-RC1 and is derived from an individual in her 50s with FTD and carrier of the tau-P301L autosomal dominant mutation (c.C1907T, rs63751273).31,188 NPCs were cultured in 6-well (Fisher Scientific Corning) or black 96-well clear bottom (Fisher Scientific Corning ...
-
bioRxiv - Cell Biology 2023Quote: ... and envelope (pMD2.G; 0.5 µg) plasmids using either FuGENE 6 or Lipofectamine 3000 transfection reagent (both from Invitrogen, Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: Whole cell extracts were resolved using a Novex™ WedgeWell™ 6% Tris-Glycine Mini Protein Gel (Thermo Fisher XP00065BOX). Samples were transferred to a polyvinylidene difluoride (PVDF ...
-
bioRxiv - Neuroscience 2023Quote: ... the hippocampus form 6-8 neonatal mice was collected from both hemispheres in Hank’s buffered saline solution (HBSS, Life Technologies). Tissue was incubated in 0.25% trypsin (Life Technologies ...
-
bioRxiv - Neuroscience 2023Quote: ... Human intestinal epithelial cells (HIEC-6) were cultured in Opti-MEM™ I Reduced Serum Medium (Thermo Scientific, MA, USA). Cell viability was measured using MTT assays (ref) ...
-
bioRxiv - Immunology 2023Quote: ... One day prior to the co-culture 70- and 20-4_1BBζ cells were defrosted and cultured in a density of 1 × 10^6 cells/mL in RPMI containing1X GlutaMAX (Gibco), 1X P/S and 10% FCS supplemented with 10 ng/mL IL7 and IL15 overnight ...
-
bioRxiv - Molecular Biology 2023Quote: ... Samples that were subjected to RNase A digestion to detect nuclease-resistant disomes were incubated for 1 h at 25 °C with 15 μl of RNase A (1:1,000 dilution) then treated with 6 μl of SUPERase-In RNase Inhibitor (Thermo Fisher). Sucrose gradients of 10-50% were prepared using a Gradient Master 108 (Biocomp ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were then washed and stained for 20 min at 4 °C with the following antibodies: anti-mouse CD8α APC-efluo780 (clone 53-6-7, ebioscience/ Thermofisher), anti-mouse CD8β AF700 or BUV495 (clone YTS156 ...
-
bioRxiv - Neuroscience 2023Quote: ... neurons were dissociated and seeded (on coverslips inside a 6 well plate: 0.2E6 cells/well) onto plates containing NB plus [Neurobasal medium supplemented with B27 (Invitrogen GIBCO Life Technologies), GlutaMAX (GIBCO) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The DNA samples were amplified in quadruplicate reactions as previously described100 using the QuantStudio 6 Flex RealTime PCR system (Applied Biosystems) using the PowerUP SYBR Green Master Mix (Applied Biosystems).
-
bioRxiv - Pathology 2023Quote: ... The samples were then incubated for 24 hours at 37°C in a standardised volume (6 mL/g of tissue) of RPMI 1640 medium (Gibco) supplemented with antibiotics and antimycotics ...
-
bioRxiv - Neuroscience 2023Quote: ... were grown to 80% confluence in 6-well culture plates and maintained in Dulbecco’s modified Eagle medium (DMEM, Gibco, USA) with 10% fetal bovine serum (Gibco ...
-
bioRxiv - Microbiology 2023Quote: ... around 3 to 5 μg total RNA from samples were loaded onto a 6% formaldehyde-containing 1% agarose gel in the fume hood with RNA Millenium Marker (Ambion) as RNA ladder ...
-
bioRxiv - Immunology 2022Quote: ... Cells were then washed twice in FACS buffer and analyzed by flow cytometry on an Attune NxT 6 cytometer (ThermoFisher). Antibodies used are shown in Supplemental Methods ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Peptides were eluted along an optimized 90 min gradient from 6 to 40% Mixture B (80% ACN/0.5% formic acid) with an EASY-nLC 1,200 system (Thermo Fisher Scientific). Spray voltage was set to 2.2 kV ...
-
bioRxiv - Genomics 2023Quote: ... then 36 cycles of 20s at 94°C and 60s at 54°C performed on an ABI9700 thermocycler followed by a final point read of the fluorescence on an ABI QuantStudio 6 real-time PCR system and using the QuantStudio software 1.3 (Applied Biosystems). For the genotyping of crude biological samples (whole blood or neutralized NaOH treatment solution of ear biopsies) ...
-
bioRxiv - Genomics 2023Quote: ... then 36 cycles of 20 s at 94°C and 60 s at 54°C performed on an ABI9700 thermocycler followed by a final point read of the fluorescence on an ABI QuantStudio 6 real-time PCR system and using the QuantStudio software 1.3 (Applied Biosystems).
-
bioRxiv - Neuroscience 2023Quote: ... fusion protein was transfected in human embryonic kidney (HEK293) cells in a 6-well format with or without full-length wild-type BACE1 using Lipofectamine 2000 (Invitrogen). After 6-8h transfection ...
-
bioRxiv - Molecular Biology 2023Quote: ... from one full NGM agar plate or from one well from 6 well plates and total RNA was isolated with Trizol (Invitrogen). DNAse treatment was achieved using DNA-freeTM ...
-
bioRxiv - Cancer Biology 2023Quote: The fragment size distribution during TMZ selection was assessed using a 6-carboxyfluorescein-labeled reverse primer in a PCR assay and a GA3500 genetic analyzer (ThermoFisher).
-
bioRxiv - Neuroscience 2023Quote: ... All qRT-PCR analyses were performed on a QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems, Thermo Fisher Scientific). Target mRNA expression was normalised for RNA loading using Gapdh (Integrated DNA Technologies) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 293T cells were plated in 6 well plates at 8 x 10^5 cells / well with DMEM / 10% FBS / NEAA / Pen-Strep (Gibco). Cells growing at ∼70-80% confluency were transfected with 1 μg of the desired expression plasmid (Sigma Aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: ... a 6-well plate of cells at approximately 80-90% confluency was harvested by treatment with trypsin without EDTA (Gibco). The staining was performed by the use of an Annexin V-FITC/PI Apoptosis Detection Kit (Vazyme) ...