Labshake search
Citations for Thermo Fisher :
751 - 800 of 10000+ citations for 3 3 2 3 Dimethyl indol 1 yl 2 hydroxy propylamino propan 1 ol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... the cerebral cortexes from 2-3 P3-P5 C57BL/6 mice were collected in ice cold HBSS (Invitrogen), the tissue was washed three times with HBSS and digested with 0.04% trypsin (Sigma ...
-
bioRxiv - Genetics 2021Quote: ... Gels were run at 120V for 2-3 hours in Bolt MES SDS Running Buffer (Thermo Fisher Scientific) prior to protein transfer to Amersham Protran nitrocellulose blotting membrane (GE Healthcare ...
-
bioRxiv - Neuroscience 2021Quote: ... supplemented with NeuroCult™ SM1 neuronal supplement (STEMCELL), L-glutamine (2 mM, PAA) and 3% horse serum (Invitrogen) at 37°C in 5% CO2 ...
-
bioRxiv - Cancer Biology 2022Quote: Tail and ear fragments from C57/B6 or mT/mG mice were dissected and incubated in 2-3 hours at 37 °C in 950 µL of Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen), supplemented with 10% inactivated fetal bovine serum (FBSi ...
-
bioRxiv - Cell Biology 2020Quote: ... and induced to differentiate in myotubes for 2-3 days in differentiation media (DM: IMDM (Gibco, 21980-032) + 2% of horse serum (Gibco ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were treated with DMNB-caged cAMP (4,5-Dimethoxy-2-Nitrobenzyl Adenosine 3’,5’-Cyclicmonophosphate, Molecular Probes, D1037) for at least 30 minutes prior to imaging at a final concentration of 1 mM ...
-
bioRxiv - Microbiology 2023Quote: ... the cells were loaded with 2 µM CellEvent™ Caspase-3/7 Green Detection Reagent (Thermo Fisher Scientific), according to the manufacturer’s instructions for kinetic assays and fluorescence in the live cells ...
-
bioRxiv - Genomics 2023Quote: ... All nuclei were pooled and stained with DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306). Using a FACSAria III cell sorter (BD Biosciences) ...
-
bioRxiv - Pathology 2023Quote: Tail and ear fragments from mT/mG mice were dissected and incubated in 2-3 hours at 37 °C in 950 µL of Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen), supplemented with 10% inactivated fetal bovine serum (FBSi ...
-
bioRxiv - Genetics 2023Quote: ... 3-5 million cells or approximately 15 ug of DNA crosslinked with 2% PFA (Fisher Scientific F79-500) were used as input per reaction ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were treated with DMNB-caged cAMP (4,5-Dimethoxy-2-Nitrobenzyl Adenosine 3’,5’-Cyclicmonophosphate, Molecular Probes, D1037) for at least 30 min prior to imaging at a final concentration of 1 mM ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Cell Biology 2024Quote: ... and a lentiviral transfer plasmid (2:3:4 ratio by mass) using Lipofectamine 3000 (Thermo Fisher Scientific L3000015). Viral supernatant was harvested 48h after transfection and filtered through 0.45 µm cellulose acetate filters (Corning 431220) ...
-
bioRxiv - Biochemistry 2023Quote: ... cells were marked with 2,3x10-3 µg/µL 4’,6-Diamidino-2-phenylindole dihydrochloride (DAPI, Thermo Fisher Scientific) for 10 min at RT in the dark ...
-
bioRxiv - Plant Biology 2023Quote: ... 3 µg RNA from each sample was used to mix with 2×RNA loading dye (Thermo Fisher Scientific), denatured at 65℃ for 10 min ...
-
bioRxiv - Genomics 2024Quote: ... Fresh medium was added every 2-3 days and cells were passaged using 1X TrypLE Express (Life Technologies).
-
bioRxiv - Developmental Biology 2022Quote: ... They were then immobilized on glass slides using 2% agarose and injected with 1,1’-dioctadecyl-3,3,3′,3′-tetramethylindocarbocyanine perchlorate (DiI, Molecular Probes) or 3,3′-dioctadecyloxacarbocyanine perchlorate (DiO ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were washed twice with PBS and loaded with 3 µM Fura-2 AM (Thermo Fisher, Waltham, MA) diluted in a modified Krebs-Ringer buffer solution [KRBH ...
-
bioRxiv - Plant Biology 2022Quote: ... equipped with an Acclaim Pepmap C18 trap column (2 cm · 75 µm, particle size: 3 µm; Thermo Fisher) and a C18 analytical column (50 cm · 75 µm ...
-
bioRxiv - Immunology 2022Quote: ... Primary B cells were plated at 2-3×106 cells/ml in primary B cell medium (DMEM (Gibco) containing 10% FBS (Sigma) ...
-
bioRxiv - Biochemistry 2022Quote: ... 2-3 µL of 5 µM protein solution was introduced directly into Q-Exactive UHMR mass spectrometer (ThermoFisher) through gold coated capillary needles that were prepared in-house30 ...
-
bioRxiv - Microbiology 2023Quote: ... Proteins were migrated for 2-3 h at 120 V in NuPAGE MOPS SDS running buffer (#NP0001, Invitrogen) and transferred onto a PVDF membrane (#1704156 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Other PCR products were run on 2 or 3% agarose gels containing Sybr Safe DNA stain (Invitrogen, #S33102) and imaged on a ChemiDoc imager.
-
bioRxiv - Bioengineering 2024Quote: ... Cells were passed every 2-3 days upon reaching ∼80% confluence using 0.05% trypsin-EDTA (Thermo Fisher Scientific) for dissociation.
-
bioRxiv - Biochemistry 2024Quote: ... 2 μl of cDNA were mixed with 3 μl of PowerUp™ SYBR™ Green Master Mix (ThermoFisher) containing 1 μM of forward and reverse primer ...
-
bioRxiv - Bioengineering 2024Quote: ... VSV-G expression plasmid and pUC19 plasmid (2:3:4 ratio by mass) using Lipofectamine 3000 (Thermo Fisher). The media was changed 6 hours post-transfection and was collected for downstream processing 48 hours post-transfection.
-
bioRxiv - Biochemistry 2024Quote: ... and 3 were cleaved from IgGs using Pierce Mouse IgG1 Fab and F(ab’)2 Preparation Kit (ThermoFisher) using protocols provided by the manufacturer ...
-
bioRxiv - Cell Biology 2024Quote: ... Beads were then washed 3 times for 3 min each with lysis buffer and RNA isolated after addition of 1 ml TRIZOL (Life Technologies cat. no. 15596-018). RNA isolated from 10% lysate was used as input ...
-
bioRxiv - Immunology 2021Quote: ... 3 μM Hoechst (Life Technologies) was added to each well to stain nuclei for cell counting ...
-
bioRxiv - Immunology 2021Quote: ... 3 μM Hoechst (Life Technologies) was added to each well to stain nuclei for cell counting ...
-
bioRxiv - Genomics 2021Quote: ... 3 mL (Thermo Fisher Scientific) overnight at 4°C ...
-
bioRxiv - Genomics 2020Quote: ... 3 washes 5x SSCT (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 washes 5x SSCT (ThermoFisher Scientific 15557044 ...
-
bioRxiv - Immunology 2021Quote: ... supplemented with 3% FBS (Gibco) and 100 U/mL penicillin-streptomycin (Gibco) ...
-
bioRxiv - Neuroscience 2020Quote: ... cleaved-caspase-3 (9H19L2-Invitrogen); TH (AB152-Merck Millipore) ...
-
bioRxiv - Bioengineering 2020Quote: ... SP-DiOC18(3) (ThermoFisher Scientific) for 20 min ...
-
bioRxiv - Neuroscience 2020Quote: sucrose (Fisher Scientific #S5-3), cellobiose [D-(+)-cellobiose ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 mM NaOH (Fisher Scientific) in neurobasal medium] and centrifugation at 800 × g for 5 min ...
-
bioRxiv - Cell Biology 2021Quote: ... The QuantStudio 3 system (Thermofisher) was used for reactions under the following conditions ...
-
bioRxiv - Systems Biology 2020Quote: ... and 3 μl RNAiMAX (Invitrogen). For every gene ...
-
bioRxiv - Microbiology 2020Quote: ... using a QuantStudio 3 (ThermoFisher). KiCqStart SYBR green primers for qRT-PCR (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... 3) Accutase (Thermo Fisher Scientific) treatment for 15 min (Figure 4E) ...
-
bioRxiv - Cell Biology 2021Quote: ... and anti-galectin 3 (ThermoFisher). Membranes were imaged using LI-COR Odyssey IR imager ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 3% sodium bicarbonate (Gibco). A549 (ATCC CCL-185 ...
-
bioRxiv - Cancer Biology 2021Quote: ... YOYO-3 (Thermo Fisher Scientific) was supplemented to the culture to detect cellular death ...
-
bioRxiv - Cell Biology 2022Quote: ... Following 3 PBS (ThermoFisher Scientific) washes ...
-
bioRxiv - Microbiology 2022Quote: ... Quantstudio 3 software (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... IL-18 (Invitrogen, BMS618-3) and TNF-α (BioLegend ...
-
bioRxiv - Developmental Biology 2022Quote: ... or TO-PRO-3 (Invitrogen) for 10 min at RT or O/N at 4°C ...
-
bioRxiv - Immunology 2022Quote: ... 3 mL (Thermo Fisher Scientific) at 4°C overnight ...