Labshake search
Citations for Thermo Fisher :
651 - 700 of 10000+ citations for 3 3 2 3 Dimethyl indol 1 yl 2 hydroxy propylamino propan 1 ol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... the skin samples were washed 2-3 times with buffer saline (1X PBS; Gibco, Thermo Fisher Scientific). The adipose tissue and associated blood vessels were removed ...
-
bioRxiv - Genomics 2020Quote: ... the skin samples were washed 2-3 times with buffer saline (1X PBS; Gibco, Thermo Fisher Scientific). The adipose tissue and associated blood vessels were removed ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were routinely passaged after 2-3 days or after reaching ∼80 % confluency using TrypLE Express (Gibco) for the detachment of cells from culture flasks ...
-
bioRxiv - Molecular Biology 2023Quote: U2OS 2-6-3 cells (Shanbhag et al., 2010) were cultured in McCoy’s 5A (Modified) Medium (Gibco) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... incubated for 2–3 minutes (mins) at room temperature in 0.05% (v/v) trypsin (Gibco 25300-054), and tapped to release ...
-
bioRxiv - Cell Biology 2023Quote: ... after the first fast centrifugation step platelets were incubated with 3 µM Fura-2 AM (#F1221, Invitrogen) and 0.2% Pluronic F-127 (#P3000MP ...
-
bioRxiv - Molecular Biology 2023Quote: ... An Acclaim PepMap 100 trap column (75 μm × 2 cm, C18, 3 μm, 100 Å, Thermo Scientific) was used together with an analytical PepMap RSLC C18 column (150 μm × 15 cm ...
-
bioRxiv - Cell Biology 2023Quote: ... DAPI (4’,6-Diamidino-2-henylindole, dihydrochloride) was obtained from Invitrogen (Catalog: D1306, CAS:28718-90-3).
-
bioRxiv - Genomics 2023Quote: ... and CRISPRmap library plasmid (2:3:4 ratio by mass) using Lipofectamine 3000 (Thermo Fisher Scientific L3000001) in lentiviral packaging medium (Opti-MEM (Thermo Fisher Scientific 31-985-070 ...
-
bioRxiv - Systems Biology 2023Quote: Total RNAs (2–3 μg) were extracted from tobacco leaves using PureLink Plant RNA Reagent (Invitrogen, #12322012) and used for cDNA synthesis with M-MLV Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Immunology 2022Quote: ... 2 μm paraffin-embedded kidney sections were incubated with an anti-cleaved caspase-3 antibody (ThermoFisher Scientific). After incubation with goat anti-rabbit-HRP secondary antibody (ThermoFisher Scientific) ...
-
bioRxiv - Cancer Biology 2022Quote: ... in the reverse phase using a preconcentration column (75 μm DI × 2 cm, 3 μm, Thermo Scientific) and an analytical column (Acclaim PepMap C18 ...
-
bioRxiv - Genetics 2022Quote: ... Cells were passaged at 70-80% confluence every 2-3 days using Trypsin 0.25% EDTA (Life Technologies). mESCs were plated at a density of 1 x 105 cells/ml ...
-
bioRxiv - Microbiology 2022Quote: PBMCs were thawed according to standard procedure and rested 2-3 h in IMDM (Gibco/ThermoFisher Scientific) containing 5% human AB serum (SAB ...
-
bioRxiv - Microbiology 2022Quote: PBMCs were thawed according to standard procedure and rested 2-3 h in IMDM (Gibco/ThermoFisher Scientific) containing 5% human AB serum (SAB ...
-
bioRxiv - Microbiology 2022Quote: ... adding 3 mL HPLC grade methanol and 2 mL HPLC grade chloroform (C297-4, Thermo Fisher Scientific), then shaking at 22°C for 1 hr ...
-
bioRxiv - Immunology 2024Quote: ... The supernatant was collected on day 3 and analyzed by human IL-2 ELISA Kit (Thermo Fisher) according to the manufacturer’s protocol.
-
bioRxiv - Genomics 2024Quote: ... A 2-3 cm2 skin biopsy harvested and transferred into NMR fibroblast medium: alphaMEM (Gibco™ 12571063) containing 15% FBS (Cytiva ...
-
bioRxiv - Immunology 2024Quote: Jurkat cells were loaded with 3 µM Fura-2 AM and 0.05% Pluronic®F-127 (Invitrogen) in imaging buffer ...
-
bioRxiv - Cell Biology 2024Quote: ... or F-12K medium (Caisson; Hela-S3 and PC-3) supplemented with 2 mM L-glutamine (Gibco), 100 U/mL penicillin ...
-
bioRxiv - Neuroscience 2022Quote: ... 10% 3 kD or 10 kD biotinylated dextran amines (3 kD BDA, Invitrogen D7135 ...
-
bioRxiv - Cell Biology 2022Quote: ... The medium was replaced at day 1 to remove non-adherent cells and afterwards every 2-3 day with DMEM/10% FBS/1% penicillin streptomycin (PS) (Gibco, USA, catalog number 15140-122). These cells were passaged serially when cells reached to 80-100 % confluency or when proliferation essentially ceased by using 0.25% Trypsin/EDTA (Gibco ...
-
bioRxiv - Cancer Biology 2023Quote: ... Patient-derived primary cell line GCDX62 was maintained in a 3:1 mixture of Keratinocyte-SFM (KSF; Thermo Fisher Scientific; supplemented with 2% (v/v) FCS ...
-
bioRxiv - Immunology 2023Quote: ... Purified T cells were activated for 1 to 3 days with Human T-Activator anti-CD3/CD28 dynabeads at a 1:2 bead-to-cell ratio (Gibco, Thermo Fisher Scientific, Waltham, MA, USA). Prior to analyses ...
-
bioRxiv - Plant Biology 2024Quote: ... 1cm long root tip sections of four plants were pooled and rolled up in a 1 x 3 cm strip of pre-moistened tissue paper and placed into 2 mL Screw Glass Vials (Thermo Scientific, Cat. No. 6PSV9-1P) filled with 200 μL of water ...
-
bioRxiv - Microbiology 2020Quote: ... COL1A1 (5’-CGAAGACATCCCACCAATC-3’ and 5’-ATCACGTCATCGCACAACA-3’), ALP (5’-TCACTCTCCGAGATGGTGGT-3’ and 5’-GTGCCCGTGGTCAATTCT-3’) (IDT, Coralville, USA) and viral non-structural (nsP1) gene (Applied Biosystems, USA) (5’-GGGCTATTCTCTAAACCGTTGGT-3’ and 5’-CTCCCGGCCTATTATCCCAAT-3’ ...
-
bioRxiv - Cancer Biology 2020Quote: ... or sgKLF5 pool (5’- GUGCGCUCGCGGUUCUCUCG-3’; 5’- AGGACGUUGGCGUUUACGUG-3’; 5’- GCGUCAAGUGUCAGUAGUCG-3’) was transfected per well using Lipofectamine™ RNAiMAX (Thermofisher, 13778150). Media was changed after 72 hours for longer treatments.
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Immunology 2022Quote: ... custom primers and probes designed to amplify and label the Chlamydia 16S gene were used (forward: 5’-GGAGGCTGCAGTCGAGAATCT-3’; reverse: 5’-TTACAACCCTAGAGCCTTCATCACA-3’; probe 5’-6FAM-TCGTCAGACTTCCGTCCATTGCGA-TAM-3’; Fisher Scientific/Eurofins).
-
bioRxiv - Molecular Biology 2023Quote: ... Naïve hESCs were routinely passaged as single cells every 3 days at a ratio of 1:3 using TrypLE™ Express (1X) (Gibco, Thermo Fisher Scientific) and plated in fresh media supplemented with 10 μM of Y-27632 (Stemcell Technologies).
-
bioRxiv - Developmental Biology 2022Quote: ... Maturation of released oocytes was induced by incubating for 1h at 16C (for P. miniata) or 20C (for P. regularis) in 3 μM 1-Methyladenine (Fisher Scientific, 5142-22-3). All embryos were raised in 0.22 μm filtered sea water (FSW ...
-
bioRxiv - Immunology 2021Quote: ... Uptake of fatty acids was quantified after incubation with 1uM 4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Hexadecanoic acid (Bodipy-FL C16, Thermo Fisher) at 37 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... or 5 µM BODIPY™ FL C5-Ceramide (N-(4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Pentanoyl)Sphingosine) (Invitrogen, D3521) together with 5 µM delipidated BSA (as a delivery carrier ...
-
bioRxiv - Cell Biology 2021Quote: ... WT and SIRT1 KO mESCs cultured in serum-free ESGRO medium or serum-containing M10 medium were incubated with 5 µM BODIPY™ FL C5-Sphingomyelin (N-(4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Pentanoyl)Sphingosyl Phosphocholine) (Invitrogen, D3522) or 5 µM BODIPY™ FL C5-Ceramide (N-(4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Pentanoyl)Sphingosine ...
-
bioRxiv - Biochemistry 2023Quote: ... BODIPY-CE (cholesteryl 4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3- dodecanoate) was obtained from Life Technologies. Lipids (with the exception of NBD-LPC ...
-
bioRxiv - Cancer Biology 2023Quote: BODIPY FL C16 (4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Hexadecanoic Acid, Invitrogen D3821) was used to assess the ability of 3T3s to transport fatty acids into the cell from their surroundings ...
-
bioRxiv - Plant Biology 2022Quote: ... pH 5.5 and 100 μM 3′,5′-dimethoxy-4′-hydroxyacetophenone (acetosyringone) (115540050; Acros Organics, dissolved in dimethyl sulfoxide (DMSO) (D8418 ...
-
bioRxiv - Cell Biology 2024Quote: BODIPY-FL-C16 (C16) (4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Hexadecanoic Acid (ThermoFisher, #D3821) or BODIPY 558/568 C12 (C12 ...
-
bioRxiv - Immunology 2024Quote: The glucose uptake in ILC2 was measured using the glucose analog 2-(N-(7-Nitrobenz-2-oxa- 1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG; ThermoFisher Scientific, Catalog No. N13195) which was stored at -20°C at a stock concentration of 10 mM (5 mg lyophilised powder in 1.46 mL dimethyl sulfoxide (DMSO)) ...
-
bioRxiv - Neuroscience 2024Quote: ... non-metabolizable glucose analogue 2-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl) amino)-2-deoxyglucose (2-NBDG) (Thermo Fisher Scientific, cat.no. 11569116). Samples were prepared as described in the section ...
-
bioRxiv - Cell Biology 2020Quote: ... plasmids (1 μg of guide RNAs +/- 3 μg donor) were diluted in 1 ml OptiMem (Gibco) and 20 ul PEI (1 mg/ml) ...
-
bioRxiv - Bioengineering 2021Quote: ... Caspase 3/7 assay solution was mixed 1:1 with αMEM without phenol red (ThermoFisher Scientific) (caspase 3/7 lysis buffer ...
-
bioRxiv - Microbiology 2022Quote: ... 1/10 volume of 3 M sodium acetate and 1 μL glycogen 10 mg/mL (Thermofisher). Pellet obtained by centrifugation 15000 x g ...
-
bioRxiv - Cell Biology 2024Quote: ... mIMCD-3 cells were cultured in 1:1 DMEM high-glucose pyruvate (41966052, GIBCO, Life Technologies): F-12 Nutrient Mixture (21765037 ...
-
bioRxiv - Cell Biology 2024Quote: ... mIMCD-3 cells were cultured in 1:1 DMEM high-glucose pyruvate (41966052, GIBCO, Life Technologies): F-12 Nutrient Mixture (21765037 ...
-
bioRxiv - Neuroscience 2022Quote: ... Hippocampal neurons 13-15 days-in-vitro (DIV) were transfected with plasmid (2 h, 2-3 µg per dish) with Lipofectamine 2000 (Invitrogen, #52887, minimum 24 h). For pH imaging experiments ...
-
bioRxiv - Plant Biology 2024Quote: ... using primers GtEFF1 (5’-CCCTGCAAGCTCTTCCTCTTAG-3’) and GtEFR1 (5’-GCATGCGAGGTCCCAAAA-3’) with the TaqMan probe (5’-6FAM-ACTGCACAGACCATC-MGB-3’) (Thermo Scientific™, USA) (Keenan et al. ...
-
bioRxiv - Cancer Biology 2024Quote: ... Real-time PCR targeting PTPRZ1 (5’-ACTCTGAGAAGCAGAGGAG-3’ and 5’-CTGTTGTCTGTAGTATCCATTAG-3’) or GAPDH (5’-TCAAGGCTGAGAACGGGAAG-3’ and 5’-CGCCCCACTTGATTTTGGAG-3’) was performed with Power SYBR™ Green PCR Master Mix (Applied Biosystems 4367659) in three technical replicates.
-
bioRxiv - Cancer Biology 2020Quote: ... Mice were immunized by injection of OVA coupled to the hapten 4-hydroxy-3-nitrophenylacetyl (NP-OVA) precipitated in alum (Imject® Alum, Thermo Scientific) into the hind footpads (25ul) ...
-
Direct analysis of ribosome targeting illuminates thousand-fold regulation of translation initiationbioRxiv - Molecular Biology 2020Quote: ... and 3′ biotinylated using the Pierce RNA 3′end biotinylation kit (Thermo Scientific 20160).