Labshake search
Citations for Thermo Fisher :
551 - 600 of 10000+ citations for 3 3 2 3 Dimethyl indol 1 yl 2 hydroxy propylamino propan 1 ol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... containing 2’-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino)-2-deoxyglucose (2-NBDG; 50 μM; Thermo Fisher Scientific). To determine FA uptake ...
-
bioRxiv - Cell Biology 2024Quote: ... Glucose was traced using 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Invitrogen, ThermoFisher, cat. #N13195) combined with 0,57 mg/mL 40kDa tetramethyl-rhodamine Dextran (Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... stained with Ghost-510 and 2-(N-Nitrobenz-2-oxa-1,3-diazol-4-yl)amino)-2-deoxyglucose (2-NBDG; 60 µM) (Thermo Fisher Scientific) (30 min at 37 C) ...
-
bioRxiv - Immunology 2024Quote: ... cells were incubated with the fluorescent glucose analog 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)-Amino)-2-Deoxyglucose (2-NBDG) (10 μM, Invitrogen, California, USA) in PBS for 30 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... (N-((6-(2,4-DNP)Amino)Hexanoyl)-1-(BODIPY® F C5)-2-Hexyl-Sn-Glycero-3-Phosphoethanolamine) was purchased from Molecular Probes (Melbourne, VIC, Australia). The TiO2 was collected from a disassembled column ...
-
bioRxiv - Microbiology 2023Quote: ... determined by preparing a slurry with 1 part soil to 2 parts deionized water and measuring (n=3) with an Orion Star A111 pH Meter (Thermo Scientific, Waltham, MA, USA), was 5.87 ± 0.42 in November 2020 and 6.28 ± 0.07 in April 2021.
-
bioRxiv - Systems Biology 2023Quote: ... 1 vein graft slide containing 2-4 cross sections was double stained with the general macrophage marker Mac-3 (rat anti-mouse, Fisher Scientific, B550292, 1:600) and either iNOS (rabbit anti-mouse ...
-
bioRxiv - Cell Biology 2023Quote: ... organoids were washed 3 times in DPBS and incubated for 2 hours with Alexa Fluor 647-conjugated anti-mouse secondary antibody (Thermo Fisher Scientific, 1:1000) in blocking buffer at RT ...
-
bioRxiv - Cell Biology 2020Quote: ... #3: 5′-GAAUAUUGAACUGGAAGCAGCACAU-3′) were purchased as Stealth RNAi siRNAs from Invitrogen. The target sequences were designed using the Block-iT RNAi Designer tool (Invitrogen ...
-
bioRxiv - Genetics 2022Quote: ... 20 mL of 3 mM of 3-deoxyadenosine (cordycepin; Thermo Fisher Scientific) was added to the buffer to obtain a final concentration of 0.6 mM (150 mg/L) ...
-
bioRxiv - Biochemistry 2023Quote: ... 5’-UUCUCCGAACGUGUCACGUTT-3’ and 5’-ACGUGACACGUUCGGAGAATT-3’ using Lipofectamine RNAiMIX reagent (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... the oligonucleotides 5’-CCTGTGCAGCCGTCCATAGGGCCTGTCAGTCAGTGGCCAAAACAGGCCTAT GAGGACGGCTGCAC-3’ and 5’-TGCTGTGCAGCCGTCCTCATAGGCCTGTTTTGGCCACTGACTGACAGGCCTATGGACGGCTGCA-3’ (#Mmi520981, Invitrogen) were used ...
-
bioRxiv - Bioengineering 2020Quote: ... Bodipy FL c16 (4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Hexadecanoic Acid, Thermofisher) was diluted in sterile RPMI-1640 (Corning ...
-
bioRxiv - Molecular Biology 2023Quote: ... the anti-3×FLAG antibody used for immunoprecipitation was cross-linked to beads by dimethyl pimelimidate (Thermo Fisher). Immunoprecipitation was performed using mouse anti-FLAG M2 or mouse non-immune IgG (negative control ...
-
bioRxiv - Immunology 2024Quote: 50 000 enriched CD11b+ LCs were seeded and incubated for 10min at 37°C with 2mM Bodipy-C11 (581/591) (4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-undecanoic acid; Invitrogen) in PBS ...
-
bioRxiv - Genomics 2020Quote: ... Day 3 SP34 (Invitrogen) with 5 ng/ml BMP4 ...
-
bioRxiv - Neuroscience 2020Quote: ... 3’-Diaminobenzidine (Invitrogen, 750118) as a substrate ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 mM DTT (Invitrogen) and 40 units RNAse OUT (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 μM MMC (ThermoFisher) for 6 hours ...
-
bioRxiv - Cell Biology 2022Quote: A 3% agarose (Invitrogen) gel solution was prepared in PBS ...
-
bioRxiv - Neuroscience 2021Quote: ... IL-3 (Life Technologies), Dexamethasone (Sigma) ...
-
bioRxiv - Systems Biology 2020Quote: ... QuantStudio 3 qPCR (Thermofisher) with KAPA Library Quantification Kit (Roche) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... on QuantStudio 3 (ThermoFisher) and data were quantified by the 2-ΔΔCT method.
-
bioRxiv - Biophysics 2023Quote: ... DiIC18(3) stain (Invitrogen). Transferrin from Human Serum ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 mL Trizol (ThermoFisher) was added to 1 mL of cellular PBS suspension in a 15 mL test tube ...
-
bioRxiv - Neuroscience 2022Quote: ... QuantStudio 3 from ThermoFisher was used ...
-
bioRxiv - Genetics 2024Quote: ... 3% ES-FBS (Gibco), 0.1 mM β-Mercaptoethanol (Gibco) ...
-
bioRxiv - Biophysics 2023Quote: ... 3 mM DDT (Invitrogen), 1.5 µM of primers listed in Supplemental Table S6 ...
-
bioRxiv - Neuroscience 2023Quote: ... 3% FBS (Invitrogen, 16140071), 1% GlutaMAX ...
-
bioRxiv - Immunology 2022Quote: ... and 3% FBS (Invitrogen). Epidermal sheets were separated from the dermis after incubation for 45 min at 37°C in 2.4 mg/ml of Dispase and 3% FBS and the epidermis was further digested for 30 min in PBS containing 1 mg/ml collagenase D ...
-
bioRxiv - Cell Biology 2024Quote: ... QuantStudio 3 (Thermo Fisher) was used for quantification using a standard curve method.
-
bioRxiv - Microbiology 2024Quote: ... and 3% _-glutamine (Gibco). Madin-Darby canine kidney (MDCK ...
-
bioRxiv - Microbiology 2024Quote: ... or TOPO-3 (Invitrogen) for 10 mins ...
-
bioRxiv - Microbiology 2024Quote: DiOC2(3) (Thermo Scientific) exhibits green fluorescence in all bacterial cells at low concentrations ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 % B27 (Gibco, 17504044), 0.1 % Glutamax ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-3-PGK (Invitrogen) was used at a 1:8000 dilution ...
-
bioRxiv - Neuroscience 2022Quote: ... dried and cover slipped under glycerol:TBS (3:1) with Hoechst 33342 (1:1000; ThermoFisher Scientific). Slides were imaged at 10X magnification on a slide scanning microscope Olympus VS120 slide scanning microscope (Olympus ...
-
bioRxiv - Microbiology 2023Quote: ... 3 μL of 1 mg mL−1 was vitrified using a Mark IV Vitrobot (Thermofisher). Prior to sample vitrification ...
-
bioRxiv - Neuroscience 2020Quote: ... Brains were washed in 3 times in 3% PBST (10 min) and incubated in goat anti-chicken Alexa Fluor 488 (Invitrogen, A11039, 1:1000) in blocking buffer at room temperature for 2hrs ...
-
bioRxiv - Developmental Biology 2024Quote: ... Maturation of released oocytes was induced by incubating for 1h at 16°C in 3 μM 1-Methyladenine (Fisher Scientific, 5142-22-3).
-
bioRxiv - Molecular Biology 2023Quote: ... Naïve hESCs were routinely passaged as single cells every 3 days at a ratio of 1:3 using TrypLE™ Express (1X) (Gibco, Thermo Fisher Scientific) and plated in fresh media supplemented with 10 μM of Y-27632 (Stemcell Technologies).
-
bioRxiv - Genetics 2021Quote: ... RNA was extracted from control and CRISPR-Cas9 targeted Calu-3 cells (N = 3 biological replicates, with 3 technical replicates per experiment per condition) and prepared using Trizol Reagent (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... mixed with forward and reverse detection primers (T3DCD S1 forward [5’- TACGCGTTGATCACGACAAT-3’] and T3DCD S1 reverse [5’- TGGCGAGATTATTCCCTGAC-3’] or GAPDH forward [5’- ACCCAGAAGACTGTGGATGG-3’] and GAPDH reverse [5’- GGATGCAGGGATGATGTTCT-3’]) and SYBR Select Master Mix (Applied Biosystems), and then subjected to PCR using the StepOnePlus Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... and customized si-KIF4 3′ UTR targeting endogenous KIF4 mRNA 3’-UTR region (5′-GGAAUGAGGUUGUGAUCUUTT-3′) were purchased from Thermo Fisher Scientific.
-
bioRxiv - Cell Biology 2020Quote: ... reverse: 5’-GGGGTCGGGAGGAACGG-3’ (Macrogen, South Korea) and beta-actin forward: 5’-CCTGGTCGGTTTGATGTT-3’ and reverse: 5’-GTGCGACGAAGACGA-3’ (Invitrogen, USA). Data analysis was made in CFX ManagerTM Software (BioRad ...
-
The skin environment controls local dendritic cell differentiation and function through innate IL-13bioRxiv - Immunology 2021Quote: ... FW 5’-CTCTCTGGGCGAAATCTGCT-3’ and REV 5’-GAGTGCTTTCGCTATGTTGTTCA-3’ for Clmn and FW 5’-TGATGGGTGTGAACCACGAG-3’ and REV 5’-GCCGTATTCATTGTCATACCAGG-3’ for Gapdh using a QuantStudio 7 (Applied Biosystems). Transcript levels are expressed as the ratio of 2−ΔCT (Transcript of interest)/2−ΔCT (Gapdh).
-
bioRxiv - Neuroscience 2022Quote: ... total RNA was extracted from freshly-dissected n=3 young (3-month-old) or n=3 aged (18-month-old) zebrafish brain in TRIzol (Invitrogen, 15596). Three independent experimental replicates were used for bulk RNA sequencing ...
-
bioRxiv - Cell Biology 2020Quote: ... rabbit anti-centrin-3 (1:1000; PA5-35865; Thermo Scientific, Rockford, USA), rabbit anti-acetylated α-tubulin (1:800 ...
-
bioRxiv - Cell Biology 2020Quote: ... 1% [w/w] P/S [Gibco] and 1 % [w/w] Glutamax [Gibco]) supplemented with 1 μM TO-PRO®-3 (Thermo Fisher Scientific). After 16 h ...
-
bioRxiv - Immunology 2021Quote: ... 3 μl of a 1:400,000 dilution of ERCC synthetic mRNAs (ThermoFisher) were added and total RNA was isolated using a Quick-RNA MicroPrep Kit (Zymo Research ...