Labshake search
Citations for Thermo Fisher :
701 - 750 of 10000+ citations for 3 3 2 3 Dimethyl indol 1 yl 2 hydroxy propylamino propan 1 ol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... sense 5’-CAAAGGACAACUGUCAGACACAGAA-3’ and antisense 5’-UUCUGUGUCUGACAGUUGUCCUUUG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 μl were sampled on a 3 well Diagnostika slides (X1XER303B) from Thermo scientific for observation on an Zeiss LSM710 confocal microscope equipped with a Plan-Apochromat 63×/1.4 Oil objective and 405 nm and 488 nm lasers ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 μg DNA and 3 μL Lipofectamine in 300 μl Optimem (Thermofisher Scientific, USA) were used per well containing 700 μl DMEM ...
-
bioRxiv - Neuroscience 2024Quote: ... wells were treated with Caspase-3/7 (CellEvent™ Caspase-3/7 Green, Invitrogen) 1:1000 in treatment media ...
-
bioRxiv - Microbiology 2023Quote: ... 3′RNA-seq libraries were analyzed on a Qubit 3 Fluorometer (Thermo Fisher Scientific) and an Agilent 4200 TapeStation System prior to paired- end sequencing using the HiSeq 2500 system (Illumina).
-
bioRxiv - Cell Biology 2024Quote: ... and 5’-TGCTGTTCTCTGTGACTCTGGATCTGGTTTTGGCCACTGACTGACCAGATCC AGTCACAGAGAA-3’ and 5’-CCTGTTCTCTGTGACTGGATCTGGTCAGTCAGTGGCCAAAACCAGATCCAGAGTCACAGAGAAC-3’ (KD2) were obtained from Invitrogen, annealed ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 mg of solid red DiI (1,1’-dioctadecyl-3,3,3’,3’-tetramethylindocarbocyanine perchlorate, Molecular Probes) dissolved in methylene chloride were mixed with 50 mg of tungsten beads (1.3 microns in diameter ...
-
bioRxiv - Cell Biology 2022Quote: Transient genetic silencing of HOIP and FLOT1/2 was performed by reverse transfection of HT-29 cells with the following siRNAs: human siHOIP (RNF31) (Silencer® Select siRNA #1 s30108, #2 s30109, #3 s30110, 40 nM) (Thermo Fisher Scientific, Waltham, MA, USA), human FLOT1 (ON-TARGETplus Human FLOT1 siRNA SMART POOL ...
-
bioRxiv - Molecular Biology 2021Quote: ... and CAF-1 p60 (5′-AAUCUUGCUCGUCAUACCA-3′) were transfected using RNAi MAX (Invitrogen).
-
Planarian CREB-binding protein (CBP) gene family regulates stem cell maintenance and differentiationbioRxiv - Developmental Biology 2020Quote: ... and TO-PRO®-3 (1:3000, Thermo Fisher Scientific, Waltham, MA, USA).
-
bioRxiv - Molecular Biology 2020Quote: ... at 1-3 mg/ml and Dynabeads® Protein G (Thermo Fisher Scientific) according to the manufacturer’s instruction.
-
bioRxiv - Immunology 2021Quote: JEG-3 cells were infected with ZIKV for 1 h in DMEM (Gibco) with 2% FCS at an MOI of 1 ...
-
bioRxiv - Neuroscience 2020Quote: ... Cell nuclei were detected with TO-PRO-3 (1:400; Thermo Fisher Scientific). The retinal and optic nerve slices were analyzed with a confocal laser-scanning microscope (LSM 510 META ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 μl of sample on a 1 mm thick glass slide (Fisher Scientific) and an 18 x18 mm cover slip (VWR ...
-
bioRxiv - Molecular Biology 2021Quote: ... siRNAs were transfected on day 1 and 3 with LipofectamineTM RNAiMAX (Thermo Fisher) and collected on day 8 for analysis ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were then treated with hexamethyldisilazane-trimethylchlorosilane-pyridine solution (3:1:9; ThermoFisher) for 20 min at 110°C ...
-
bioRxiv - Physiology 2020Quote: ... 1 h with oxygenated water 3% (Tyramide Superboost Kit, B40922, Thermo Fisher, USA) and ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were split 1:10 every 3 days by using trypsin (Gibco, 25200072).
-
bioRxiv - Neuroscience 2022Quote: ... Cell nuclei were detected with TO-PRO-3 (1:400; Thermo Fisher Scientific). To analyze PNN structure and to detect synaptic proteins ...
-
bioRxiv - Neuroscience 2021Quote: ... samples were then incubated with TO-PRO-3 (Thermo Fisher, T3605, 1:300), goat anti-rat Alexa Fluor 568 (Thermo Fisher ...
-
bioRxiv - Neuroscience 2021Quote: ... A final incubation of 3 min with DAPI (1:1000, Thermo Fisher Scientific) was done ...
-
bioRxiv - Microbiology 2021Quote: ... followed by DNA staining with 1 µM TOPRO-3 iodide (642/661; Invitrogen) and staining of the fungal hyphae with 100 μg/ml Fluorescent Brightener 28 (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2022Quote: ... slides were treated with DAPI (1:500, 3 min RT, ThermoFisher Scientific, D1306), washed briefly in PBS (2x) ...
-
bioRxiv - Genetics 2021Quote: ... Nuclei were stained with TO-PRO-3 (Topro, Invitrogen, T3605; 1:3000 dilution).
-
bioRxiv - Pathology 2021Quote: ... Membranes were blocked for 1 hour at RT with 3% BSA (Thermo Fisher) in tris-buffered saline with 0,1% Tween (TBS-T ...
-
bioRxiv - Developmental Biology 2021Quote: ... and cultured in a 3:1 mixture of IMDM (ThermoFisher Scientific Cat. 12440053) and Ham’s F12 (ThermoFisher Scientific Cat ...
-
bioRxiv - Microbiology 2021Quote: ... and primer sequences (Table 1) on a QuantStudio 3 platform (Applied Biosystems, USA). The relative expression levels of target genes were plotted as fold change compared with untreated or negative controls ...
-
bioRxiv - Immunology 2020Quote: ... 100 μl) mixed with Alum (1:3 v/v) (ThermoFisher, Waltham, MA, USA). HBc-S was used as a control ...
-
bioRxiv - Cell Biology 2023Quote: ... DNA and lipofectamine (1:3 w/v) were diluted in Opti-MEM (Gibco) and incubated at room temperature (RT ...
-
bioRxiv - Molecular Biology 2023Quote: ... and primary antibodies for 3 days: chicken anti-GFP (1:750, Thermo Fisher Scientific Cat# A10262 ...
-
bioRxiv - Immunology 2023Quote: ... for 3 h and goat anti-rat AF 633 (1:200, Life technologies) for 1 h diluted in PBS containing 4 % BSA and 1 % goat serum at RT in a humidified dark chamber ...
-
bioRxiv - Microbiology 2024Quote: ... or streptavidin-HRP (1:1000 dilution, Fisher Scientific, Novex Cat# 43-423-3) to ensure that biotinylated and bait proteins were present ...
-
bioRxiv - Biophysics 2023Quote: ... NucGreen™ Dead 488 (Invitrogen™, 1 drop per 3 ml in PBS); Alexa 647 Phalloidin (Invitrogen™ at 1/500) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 U/ml EPO (Zyrop 4000 IU injection) and 1× Pen-Strep (Gibco) as per established protocols ...
-
bioRxiv - Cell Biology 2023Quote: ... INS-1 832/3 cells were transfected with 40 nM of Control (Ambion Silencer Select Negative Control #1 siRNA ...
-
bioRxiv - Microbiology 2023Quote: ... Tissues were maintained in E-medium (3:1 ratio of DMEM:F12 (Thermofisher, 21765029) medium supplemented with 10 % FBS and 1 % PS ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 1 mM 3’-d-GTP [>99% purity for UTP and CTP (ThermoFisher); ≥95% purity for 3’-dGTP (Jena Bioscience)] and incubated 2 min at 37°C (to “chase,” and thereby to stabilize ...
-
bioRxiv - Biophysics 2022Quote: ... Cells were split 1:10 every 3 days by using trypsin (Gibco, 25200072).
-
bioRxiv - Cancer Biology 2022Quote: ... incubated for 3 minutes in Hoechst nuclear stain (1:1000 in H2O, Thermofisher), and mounted with Vectashield (VectorLaboratories ...
-
bioRxiv - Synthetic Biology 2022Quote: ... for assembly into levels 1 and 3 or 10 U BpiI (Thermo Scientific) for assembly into levels 2 in 20 μl 1x T4 ligase buffer (NEB) ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.05% Tween-20 in PBS along with 1:1000 To-Pro-3 (Invitrogen) for 2h at RT ...
-
bioRxiv - Developmental Biology 2023Quote: ... species-specific secondary antibodies (Life Technologies; 1:300 dilution in 3% BSA/PBS). Images were collected on a Zeiss Axioimager.D2 upright microscope using a 63x/Plan-neofluar objective and captured using a Coolsnap HQ2 camera (Photometrics ...
-
The integrated stress response promotes macrophage inflammation and migration in autoimmune diabetesbioRxiv - Immunology 2024Quote: ... The embryos were immunostained with TO-PRO-3 (Thermo Fisher; T3605; 1:1000) to identify the nuclei and images were captured using an A1 confocal microscope (Nikon) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and sgRNAs at a 1:3 molar ratio in Neon buffer R (Invitrogen) and incubating at room temperature for 10 min ...
-
bioRxiv - Neuroscience 2021Quote: ... Cultured neurons were incubated with 3 μg/mL of the ratiometric calcium indicator Fura-2 AM (Life Technologies) in external recording solution for 30 min at 37°C and 5% CO2 ...
-
bioRxiv - Neuroscience 2020Quote: ... was aspirated and the fixed cells treated with 2-3 drops of ProLong Gold Antifade Mountant (Invitrogen #P36930) before imaging ...
-
bioRxiv - Plant Biology 2020Quote: ... seedlings were washed for 2-3 min in water and transferred to a chambered cover glass (Thermo Scientific), and imaged either as described above or using a Leica DM5500 wide field microscope (GFP filtercube ex ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA was reverse-transcribed by addition of 3 μl of RT mix (2 μl 5x SSIV buffer [Invitrogen] ...
-
bioRxiv - Cancer Biology 2021Quote: ... After 3 and 7 days of treatment cells were stained with 2% crystal violet (CV) (40583100, Acros Organics, Fisher Scientific ...
-
bioRxiv - Biochemistry 2022Quote: ... equipped with an Acclaim Pepmap C18 trap column (2 cm * 75 µm, particle size: 3 µm; Thermo Fisher) and a C18 analytical column (50 cm * 75 µm ...