Labshake search
Citations for Thermo Fisher :
7801 - 7850 of 10000+ citations for 7 Chloromethyl 2 2 dimethyl 2 3 dihydro 1 benzofuran since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2020Quote: The graphene-FET was immersed in 2-methoxyethanol solution containing 1 mM PBASE (Thermo Fisher Scientific Inc.) for 1 hour ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNAs encoding the candidates in step 1 and step 2 were cloned into the pDisplay vector (Invitrogen) with an IgK leader sequence in the sensor upstream ...
-
bioRxiv - Microbiology 2021Quote: ... actin was stained with phalloidin-488 (diluted 1:400 in PBS with 2% BSA; Life Technologies, P3457) for 30 min at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... actin was stained with phalloidin-568 (diluted 1:500 in PBS with 2% BSA; Life Technologies, A12380) for 30 min at room temperature ...
-
bioRxiv - Biophysics 2020Quote: ... Nuclei were detected by staining with 4’,6-diamidino-2-phenylindole (DAPI, 1:200, ThermoFisher Scientific, USA) for 10 minutes at RT ...
-
bioRxiv - Neuroscience 2020Quote: ... the medium was changed to Neurobasal + 2% B27 + 0.25% L-Glutamine + 1% Penicillin-Streptomycin (all from Gibco). Half of the medium was replaced every 2-3 days ...
-
bioRxiv - Immunology 2020Quote: ... and Rabbit anti-Human IgG F(ab’)2 HRP Secondary Antibody (ThermoFisher Scientific Catalog #31482, 1:10,000).
-
bioRxiv - Pathology 2021Quote: ... of PBX1-1 (CCCAGGUAUCAAACUGGUUUGGAAA and UUUCCAAACCAGUUUGAUACCUGGG) and of PBX1-2 (GCCAAGAAGUGUGGCAUCACAGUCU and AGACUGUGAUGCCACACUUCUUGGC) were purchased from Invitrogen. Cells were treated with siRNA at a final concentration of 100 nM using Lipofectamine RNAiMAX according to the manufacturer’s instructions (Invitrogen) ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were transfected with 1 µg of plasmid DNA and 2 µL of Lipofectamine 2000 reagent (Invitrogen). Six hours post transfection ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 kPa polyacrylamide gels were made using 2 µL of blue fluorescent beads (200 nm; Thermo Fisher), 18.8 µL of 40% acrylamide solution (cat no ...
-
bioRxiv - Cancer Biology 2022Quote: ... All lysis buffers contained 2 μg mL-1 aprotinin (#78432, Thermo Fisher Scientific Inc., New York, NY), 1 mM PMSF (329-98-6 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1x Protease inhibitor cocktail) containing 2 mM EDTA and 1 µl of H3K27me3 antibody (ThermoFisher, MA5-11198). The mixture was incubated overnight at 4 °C for antibodies to bind ...
-
bioRxiv - Cancer Biology 2022Quote: ... The RNP complex was assembled at 1:2 molar ratio of TrueCut™ Cas9 Protein v2 (Invitrogen) to synthesised gRNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cells were triturated in Neurobasal-A medium (2% B27, 1% Glutamax, 0.2% P/S; (Thermo Fisher Scientific)) by gentle pipetting up and down ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Samples were then filtered through: 1) 100 μm nylon strainers and 2) 70 μm nylon strainers (ThermoFisher).
-
bioRxiv - Physiology 2022Quote: ... Diluted primary antibody (100 µL of 1:200 rat anti-rabbit a-tubulin, Clone YL1 / 2, Invitrogen) was pipetted onto the Parafilm and the coverslips were placed cell-side down on top of the solution and incubated at 4 °C for 1 hour ...
-
bioRxiv - Biophysics 2022Quote: ... Cells were then mixed with a solution of polystyrene beads (1 µm diameter, 2% solids, Invitrogen, F8816) in proportion of 100 µl beads/500µl cell solution ...
-
bioRxiv - Biophysics 2020Quote: ... and supernatants were batch bound for 1 hour with 2 mL HisPure Ni-NTA agarose beads (ThermoFisher) and equilibrated with wash buffer (50 mM Tris pH 7.5 ...
-
bioRxiv - Cell Biology 2021Quote: ... The tissue was then stained with 2 µg mL-1 of Hoechst 33342 (ThermoFisher Scientific, MA, USA) for 15 minutes at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... coverslips were incubated for 2 hours in secondary antibody [Goat-anti-rabbit (1:3000; Alexafluor 568, Invitrogen, ThermoFisher Scientific ...
-
bioRxiv - Bioengineering 2021Quote: ... buffered with 10mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Life Technology, Thermo Fisher Scientific Inc., USA) and coated with 20 μg/mL laminin (Sigma Aldrich ...
-
bioRxiv - Neuroscience 2020Quote: ... sections were counterstained with 4’,6-diamidine-2’-phenylindole dihydrochloride (DAPI, D3571, Molecular Probes, dilution 1:1000), re-washed ...
-
bioRxiv - Neuroscience 2022Quote: ... neuronal rosettes were passaged as small clusters in a 1:2 ratio using EZPassage (Invitrogen, Waltham MA) and plated on poly-O/laminin-coated 6-well plates ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... stock solutions were made in 25 mM 4-(2-hydroxyethyl)-1-piperazine ethanesulfonic acid (HEPES, Fisher Scientific). The thrombin-selective inhibitor PPACK.2HCl and MMP Inhibitor V (ONO-4817 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1 x 106 of cells were blocked with 2 µL of CD16/CD32 (Invitrogen, #14-0161-82) for 10 minutes on ice ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by 1 to 2 hours with goat anti-rabbit Alexa 647–conjugated antibody (ThermoFisher Scientific, A21245) at 1:1000 dilution ...
-
bioRxiv - Developmental Biology 2021Quote: ... and washed twice with 2 ml 1× Dulbecco’s phosphate-buffered saline (DPBS) (Gibco, 14190136, Carlsbad, CA, USA) solution containing 2% fetal bovine serum (Gibco ...
-
Blunted Fas signaling favors RIPK1-driven neutrophil necroptosis in critically ill COVID-19 patientsbioRxiv - Immunology 2021Quote: ... the cellular fraction of the blood was diluted 1:2 with Dulbecco’s phosphate buffered saline (DPBS, Gibco) and neutrophil enrichment cocktail was added for 15 min ...
-
bioRxiv - Physiology 2020Quote: ... The membrane was probed with primary antibodies for α-Tubulin (ThermoFisher 322588, clone B-5-1-2), acetylated (Sigma T7451 ...
-
bioRxiv - Immunology 2020Quote: ... Cells were stained as follows: 1-blocking with 2 μg/mL FcBlock (anti mouse CD16/CD32, Invitrogen) for 1 h at RT in microscopy buffer (5% w/V BSA (Sigma) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and coverslips were mounted after adding 1-2 drops of ProLong™ Anti-fade reagent (ThermoFisher; P10144). The mountant cured for 24 hours to achieve the best refractive index before imaging ...
-
bioRxiv - Neuroscience 2021Quote: ... incubated (2 hours) with secondary antibody (1:500 Alexa-555 goat-anti-rabbit; A-21428, Thermo Fisher) in 0.3% Triton X-100 and 2% NGS.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and supplemented with Pen/Strep (1%, Bioconcept, Allschwil, CH) and 2% fetal bovine serum (FBS, Gibco, Thermofisher), at 37°C in a humidified atmosphere with 5% CO2.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and supplemented with Pen/Strep (1%, Bioconcept, Allschwil, CH) and 2% fetal bovine serum (FBS, Gibco, Thermofisher), at 37°C in a humidified atmosphere with 5% CO2.
-
bioRxiv - Physiology 2021Quote: ... and stained for 2 hours with Alexa Fluor™ 555 Phalloidin (1:200, Thermo Fisher Scientific – A34055) at room temperature ...
-
bioRxiv - Immunology 2021Quote: ... The brains were cleared in BABB (2:1 benzyl alcohol (Honeywell, 108006)/benzyl benzoate (Acros organics, 105862500)) overnight ...
-
bioRxiv - Microbiology 2022Quote: ... The remainder was stained using FITC-conjugated F(ab’)2-Goat anti-human IgA (Invitrogen; 1/1000) in PBS + 0.1% BSA (Fraction V ...
-
Rac1, Rac3 GTPases and TPC2 are required for axonal outgrowth and migration of cortical interneuronsbioRxiv - Neuroscience 2022Quote: ... (2% B27 supplement, 0.5% glucose, 1X Glutamax, 1% Pen/Strep, in Neurobasal medium –phenol red, all Gibco) in a 5% CO2 humidified incubator at 37 °C as previously described (Vidaki et al. ...
-
bioRxiv - Biochemistry 2022Quote: ... 1% nonessential amino acids (1140050) and 50μM 2-mercaptoethanol (31350-010) (all Thermo Fisher Scientific unless specified), 1,000 U/ml LIF (ESGRO ESG1107 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1×106 Fh1 fl/fl or 2×106 Fh1 -/- cells were plated onto 15-cm dishes (Nunc) and allowed to reach 80% confluency ...
-
bioRxiv - Developmental Biology 2022Quote: ... the cells were resuspended in 1 ml DMEM containing 2 μl Hoechst 33342 (62249, Thermo Fisher Scientific), 2 μl Zombie Aqua dye (423101 ...
-
bioRxiv - Cell Biology 2022Quote: ... and aliquots of 1 × 106 cells were placed into 2-mL cryovials (Thermo Fisher Scientific, Waltham, USA). Cells were pelleted by centrifugation for 5 min at 160 x g ...
-
bioRxiv - Neuroscience 2022Quote: ... washed and incubated for 2 h with Alexa Fluor 594-conjugated secondary antibody (1:1,000; Life Technologies). After a final washing step ...
-
bioRxiv - Microbiology 2022Quote: ... 2 μL 20U/μl SuperaseIn and 1 μL 200 U/μL SuperScript III Reverse Transcriptase (Life Technologies). First-strand cDNA was synthesized by incubating the sample for 10 minutes at 25°C ...
-
bioRxiv - Microbiology 2022Quote: ... 2 μL 20U/μl SuperaseIn and 1 μL 200 U/μL SuperScript III Reverse Transcriptase (Life Technologies). First-strand cDNA was synthesized by incubating the sample for 10 minutes at 25°C ...
-
bioRxiv - Physiology 2023Quote: ... pH 7.5) and incubated for 2 hours with secondary antibodies (1:1000, Thermo fisher Scientific, MA, USA) conjugated with fluorescent dyes ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were counterstained with 4’,6-diamino-2-phenylindole dihydrochloride (DAPI, 1:10000 in PBS, Thermo Scientific) and mounted with a cover glass using Fluoromount (Diagnostic BioSystems ...
-
bioRxiv - Molecular Biology 2022Quote: ... containing 10% (v/v) fetal bovine serum (FBS) and 2 mmol L-1 L-glutamine (Life Technologies) in 5% CO2 in a humidified atmosphere at 37 °C and subjected to regular mycoplasma testing ...
-
bioRxiv - Neuroscience 2022Quote: ... Nuclei were visualized with Hoechst (4′,6-diamidino-2-phenylindole) (DAPI) (Invitrogen; 3258, ICC/IHC 1:5,000).
-
bioRxiv - Physiology 2022Quote: ... Nuclei were stained with 4′,6-diamidino-2-phenylindole (1:2500, DAPI, ThermoFisher Scientific, Cat No. D1306). Images were taken using Zeiss 880 confocal microscopy and quantified by using Fiji/ImageJ86.