Labshake search
Citations for Thermo Fisher :
7551 - 7600 of 10000+ citations for Recombinant Human FCGRT & B2M Protein His Avi Strep II tagged Biotinylated since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... using the Gateway®LR Clonase™II Enzyme Mix (Invitrogen). Details of all plasmids are available in Supplementary Data 17 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2X PlatinumTM SuperFiTM II PCR Master Mix (Invitrogen, Cat. No. 12368010), 0.5µl cDNA template and DNase free water to an adjusted volume of 25µl ...
-
bioRxiv - Molecular Biology 2023Quote: ... Sf9 cells were cultured in Sf-900TM II SFM medium (Gibco) and maintained at 27°C and 90 rpm.
-
bioRxiv - Molecular Biology 2023Quote: ... Superscript II RNase H- system and Oligo dT (Invitrogen, CA, USA) were used to reverse transcribe the mRNA to cDNA ...
-
bioRxiv - Microbiology 2023Quote: Symbiodiniaceae cultures cell counts were quantified (Life Technologies Countess II FL) and an aliquot of 106 cells was deposited in a 5-μM mesh size strainer (pluriSelect ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 0.4 ul of Phire Hot Start II DNA Polymerase (Thermo Scientific), and 10 ng of gDNA ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 0.4 ul of Phire Hot Start II DNA Polymerase (Thermo Scientific), and 10 ng of cDNA ...
-
bioRxiv - Bioengineering 2023Quote: ... and cloned into pCR-Blunt II-TOPO® (Thermo Fisher Scientific). cDNAs were incorporated into pcDNA3 (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2023Quote: ... The cell number was determined (Countess II F2, Thermo Fisher Invitrogen), and 3 ∙ 107 cells were used for each sample ...
-
bioRxiv - Biochemistry 2023Quote: ... The cell number was determined (Countess II F2, Thermo Fisher Invitrogen), and 3 ∙ 107 cells were used for each sample ...
-
bioRxiv - Biochemistry 2022Quote: ... The sen cDNA was ligated into plasmid blunt II Topo (Invitrogen) and then transformed into TOP10 competent Escherichia coli cells ...
-
bioRxiv - Biochemistry 2022Quote: ... falciparum actin II was expressed in Spodoptera frugiperda Sf9 cells (Invitrogen) at 27°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Reverse transcription was performed using the Superscript II RT kit (Invitrogen) with random hexamer primers (Roche ...
-
bioRxiv - Cell Biology 2023Quote: Tissues were homogenized with Qiagen TissueLyser II in Trizol reagent (Invitrogen), and cells were scrapped with Trizol reagent (Invitrogen) ...
-
bioRxiv - Genomics 2022Quote: ... Platinum™ II Hot-Start Green PCR Master Mix (2X) (Invitrogen) was used ...
-
bioRxiv - Genetics 2022Quote: ... and cDNA generated with SuperScript II reverse transcriptase (Invitrogen, Carlsbad, CA) as described in the Illumina kit ...
-
bioRxiv - Immunology 2023Quote: ... Total RNA was retro-transcribed using the superscript II polymerase (Invitrogen), in combination with random hexamers ...
-
bioRxiv - Immunology 2023Quote: ... Phusion DNA polymerase and BP Clonase II were purchased from ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... to 10 μL TaqMan Universal Master Mix II (Applied Biosystems, 4440043) was prepared for each probe ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was generated with SuperScript II Reverse Transcriptase Kit (Thermo Fisher) and amplified with HiFi HotStart PCR Mix (KAPA Biosystems) ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA was synthesized using Super Script II (Thermo Fisher, Cat# 18064014), followed by end repair ...
-
bioRxiv - Neuroscience 2023Quote: cDNA synthesis was carried out using SuperScript II Reverse Transcriptase (Invitrogen) following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... and live cells were counted using the Countess II (Thermo Fisher).
-
bioRxiv - Immunology 2023Quote: ... PE-Cyanine7 Rat Anti-Mouse IgM (Clone II/41; ThermoFisher(Ebioscience); Cat#25-5790 ...
-
bioRxiv - Plant Biology 2023Quote: ... by using Gateway® LR Clonase® II enzyme mix (Invitrogen). PCR fragments of about 400-600 bp of single MtYUCs and MtPINs genes for RNAi constructs were generated on cDNA made from Medicago nodule or root RNA ...
-
bioRxiv - Genetics 2023Quote: ... 1 unit of Phusion Hot Start II DNA Polymerase (Thermo Fisher), 10 ul of 5X HF buffer ...
-
bioRxiv - Microbiology 2023Quote: ... or RS treated glass chamber slides (154526, Nunc, Lab Tek II). Overnight S ...
-
bioRxiv - Genetics 2023Quote: ... and cDNA was synthesized with SuperScript™ II Reverse Transcriptase (Invitrogen). The HAC1 spliced and unspliced fragments were amplified with intron-spanning primers (ACCTGCCGTAGACAACAACAAT and AAAACCCACCAACAGCGATAAT ...
-
bioRxiv - Neuroscience 2023Quote: ... The RNA was reverse transcribed with Superscript II Reverse Transcriptase (Invitrogen). The cDNA samples that passed quality control were used to generate sequencing libraries using the Nextera XT DNA Library Preparation Kit (Illumina) ...
-
bioRxiv - Biochemistry 2023Quote: ... reverse transcription was performed with Superscript II reverse transcriptase (Thermo Scientific) at 42 °C ...
-
bioRxiv - Genetics 2023Quote: ... cDNA conversion was performed combining the SuperScript II Reverse Transcriptase (Invitrogen) with the Reverse Transcription System kit (Promega ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were counted using a Countess II™ (Thermo Fisher Scientific) and 3 million cells were taken for staining with the cocktail of antibodies.
-
bioRxiv - Plant Biology 2023Quote: ... pEarleyGate104 and pEarleyGate201 destination vectors (56) via LR Clonase II (Invitrogen) from their entry vectors ...
-
bioRxiv - Immunology 2023Quote: ... Viability and cell count were assessed using a Countess II (ThermoFisher). Equilibrium to targeted cell recovery of 6,000 cells along with Gel Beads and reverse transcription reagents were loaded to Chromium Single Cell A to form Gel-bead-in Emulsions (GEMs) ...
-
bioRxiv - Cell Biology 2024Quote: ... digested sequentially with 0.2% collagenase type II (Gibco, Grand Island, NY) and 0.25% trypsin (Gbico ...
-
bioRxiv - Biophysics 2024Quote: Sf9 cells were cultured in Sf-900 II SFM medium (GIBCO) supplemented with 5% (v/v ...
-
bioRxiv - Biochemistry 2024Quote: ... and stained with SYBR Green II RNA stain (Thermo Fisher Scientific).
-
bioRxiv - Biophysics 2024Quote: SH-SY5Y cells seeded onto Lab-Tek II imaging dishes (Nunc) 5 × 104 cells per mL and incubated for 24 h ...
-
bioRxiv - Cell Biology 2024Quote: Class II Biological Safety Cabinet MSC-Advantage (ThermoFisher, cat. no.51025411)
-
bioRxiv - Bioengineering 2024Quote: ... Cells were counted using an automated cell counter (Countess II, Invitrogen).
-
bioRxiv - Molecular Biology 2024Quote: ... the cells were lysed using Cell Lysis Buffer II (ThermoFisher Scientific). A total of 100 μg of protein was diluted with 500 μl of PBS and incubated with 10 μl of 1 mM peptides for 2 h at 4 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... immediately followed by reverse transcription using the Superscript II system (Invitrogen) with oligo dT primers ...
-
bioRxiv - Plant Biology 2024Quote: ... using the LR ClonaseTM II enzyme according to the manual (Invitrogen) to generate p35S::MpPINW- ...
-
bioRxiv - Neuroscience 2024Quote: ... cells were cultured in fibroblast medium II (DMEM/F-12 (Gibco), supplemented with 1% GlutaMAX Supplement (Gibco) ...
-
bioRxiv - Plant Biology 2024Quote: ... and cDNA synthesis was conducted using Superscript II (18064014, Invitrogen, USA) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... Super Bright 645-labeled MHC II (M5/114.15.2, Thermo Fisher Scientific), BV421-labeled PD-L1 (MIH5 ...
-
bioRxiv - Cell Biology 2024Quote: ... coated 4-well Nunc Lab-Tek II Chamber Slides (Thermo Scientific). At day 8 of differentiation ...
-
bioRxiv - Cancer Biology 2024Quote: ... or TaqMan Universal Master Mix II (Applied Biosystems, Carlsbad, CA, USA). All reactions were performed in triplicate ...
-
bioRxiv - Physiology 2024Quote: ... and reversely transcribed into cDNA using Superscript II 10000U (#2409783, Invitrogen). The mRNA expression levels were determined by real-time quantitative RT-PCR using an Applied Biosystems (QuantStudio 7 Flex ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5,000 RFP-tagged A375 or SK-MEL-24 cells were mixed with 5,000 GFP-tagged CAFs in one well of a U-bottomed 96-well plate (Thermo Fisher Scientific, Rochester, NY). Spheroid was formed by centrifuging the plate at 1,000 g for 10 minutes followed by incubation at 37°C in a humidified incubator with 5% CO2 overnight ...