Labshake search
Citations for Thermo Fisher :
7501 - 7550 of 10000+ citations for Recombinant Human FCGRT & B2M Protein His Avi Strep II tagged Biotinylated since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... and the Super Script II kit(Invitrogen, Carlsbad, California, United States) following manufacturer’s instructions with the addition of Rnasin (Promega) ...
-
bioRxiv - Developmental Biology 2022Quote: E10.5 limb buds were dissected and incubated in Dispase II (Gibco) solution for 30min at 37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA was reverse transcribed using Superscript II Reverse Transcriptase (Invitrogen #18064022), and qPCR was carried out using 1.5 µl of cDNA ...
-
bioRxiv - Plant Biology 2022Quote: ... and cDNA was synthesized using SuperScript II Reverse Transcriptase (Invitrogen, USA). qRT-PCR was performed using a CFX96 Touch Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Plant Biology 2022Quote: ... using Gateway™ BP Clonase II Enzyme Mix (Thermo Fisher Scientific) and subsequently into pUB-RFP-DEST (Grefen et al. ...
-
bioRxiv - Microbiology 2022Quote: ... was performed using Super Script II Reverse transcriptase (Thermo Fisher Scientific) and Expanded High Fidelity PCR System (Sigma Aldrich) ...
-
bioRxiv - Microbiology 2022Quote: ... All PCRs were performed with SuperFi II PCR master mix (Invitrogen). The fragments were then joined by PCR ...
-
bioRxiv - Physiology 2022Quote: ... cDNA was prepared using Superscript II first strand synthesis kit (Invitrogen). Taqman gene-specific RT-PCR primer pairs were used with the ABI Prism 7000 (as follows ...
-
bioRxiv - Plant Biology 2022Quote: ... The cDNA was then synthesized by reverse-transcriptase (Superscript II, Invitrogen). The primers used for NifD ...
-
bioRxiv - Neuroscience 2022Quote: ... immediately followed by reverse transcription using the Superscript II system (Invitrogen) with oligo(dT ...
-
bioRxiv - Immunology 2022Quote: ... Super Bright 645-labeled MHC II (M5/114.15.2, Thermo Fisher Scientific), BV421-labeled PD-L1 (MIH5 ...
-
bioRxiv - Neuroscience 2023Quote: ... and reverse-transcribed using SuperScript II (Thermo Fisher Scientific, 18064-022). Real-time PCR was performed using the primers (F ...
-
“Identification of microRNAs regulated by E2F transcription factors in human pluripotent stem cells”bioRxiv - Developmental Biology 2024Quote: ... cDNA was generated using SuperScript™ II Reverse Transcriptase (Thermo Scientific) and miRNA-specific stem-loop primers as previously described [14] ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.5 μL SuperScript II Reverse Transcriptase (Thermo Fisher Scientific Cat# 18064014) and 0.5 μL RNAse free water per sample ...
-
bioRxiv - Molecular Biology 2022Quote: ... Sf9 cells were cultured in Sf-900TM II SFM medium (Gibco) and maintained at 27 °C and 90 r.p.m.
-
bioRxiv - Immunology 2022Quote: ... The viability of the cells was evaluated by Countess II (Invitrogen) and Trypan Blue (ThermoFisher) ...
-
bioRxiv - Cell Biology 2022Quote: ... Gateway® LR Clonase® II enzyme mix (Thermo Fisher Scientific) was used according to the manufactureŕs instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was reverse transcribed using Superscript II Reverse Transcriptase (Life Technologies) with random primers (Invitrogen ...
-
bioRxiv - Biophysics 2023Quote: ... The bacmid was transfected to sf9 cells using Cellfectin-II (Invitrogen) to produce baculovirus ...
-
bioRxiv - Microbiology 2023Quote: ... or in Tab-Tek II CC2 chamber slides (Thermo Fisher Scientific). Separate wells were seeded for each assay to process ...
-
bioRxiv - Biophysics 2024Quote: The MDCK II cell lines were cultured in MEM (Gibco 410900028) with 5 % Fetal Bovine Serum (Sigma ...
-
bioRxiv - Biophysics 2024Quote: ... 1× Phire Hot Start II PCR Master Mix (ThermoFisher Scientific F125L). The reaction proceeded for 9 cycles of 98°C for 10 seconds ...
-
bioRxiv - Cancer Biology 2024Quote: ... prostates were harvested and subsequently digested with collagenase type II (Gibco) for 2 hrs at 37 °C ...
-
bioRxiv - Cell Biology 2024Quote: SuperScript II Reverse Transcriptase 200 U (Life Technologies, Carlsbad, CA, USA)
-
bioRxiv - Cell Biology 2024Quote: ... cDNA was synthesized using Superscript II RNase H-Reverse transcriptase (Invitrogen) and random hexamers (Applied Biosystems) ...
-
bioRxiv - Genomics 2024Quote: ... we utilized the Gateway BP Clonase II Enzyme Mix from Invitrogen to insert the 3’ UTR region into pDONR P2r-P3 Gateway entry vectors ...
-
bioRxiv - Genetics 2023Quote: ... The RT step was modified to utilize SuperScript II (Thermo Fisher) and a custom 5X First-Strand Buffer containing MnCl2 (250 mM Tris-HCl ...
-
bioRxiv - Genetics 2023Quote: ... and cDNA was synthesized with SuperScript™ II Reverse Transcriptase (Invitrogen). The HAC1 spliced and unspliced fragments were amplified with intron-spanning primers (ACCTGCCGTAGACAACAACAAT and AAAACCCACCAACAGCGATAAT ...
-
bioRxiv - Genetics 2023Quote: ... 1 unit of Phusion Hot Start II DNA Polymerase (Thermo Fisher), 10 ul of 5X HF buffer ...
-
bioRxiv - Neuroscience 2022Quote: ... (ii) polyclonal goat anti-rabbit Alexa Fluor 488 (A11008, Life Technologies), (iii ...
-
bioRxiv - Biochemistry 2022Quote: ... Sf9 cells were cultured in Sf-900 II SFM medium (Gibco) at 27 °C.
-
bioRxiv - Neuroscience 2023Quote: ... RNA amplification was done using MessageAmp II aRNA Amplification Kit (ThermoFisher) according to manufacturer’s instructions except for the aRNA purification where we used Trizol to increase the recovery rate ...
-
bioRxiv - Molecular Biology 2023Quote: ... before reverse-transcription (RT) with the Superscript II or III (Invitrogen) and library preparation ...
-
bioRxiv - Microbiology 2022Quote: ... 1X PlatinumTM II PCR Buffer (Thermo Fisher ScientificTM Brazil, Lot 01120395), 10 mM dNTP mix (Thermo Fisher ScientificTM Brazil ...
-
bioRxiv - Microbiology 2023Quote: ... 2 μL of 10x AccuPrime PCR Buffer II (Thermo Fisher Scientific), 11.85 μL of PCR-grade water ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were counted using a Countess II™ (Thermo Fisher Scientific) and 3 million cells were taken for staining with the cocktail of antibodies.
-
bioRxiv - Neuroscience 2023Quote: ... 4 mg Collagenase NB4 (Serva) and 4.6 mg Dispase II (Gibco) was added to the ganglia ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2X PlatinumTM SuperFiTM II PCR Master Mix (Invitrogen, Cat. No. 12368010), 0.5µl cDNA template and DNase free water to an adjusted volume of 25µl ...
-
bioRxiv - Cancer Biology 2023Quote: ... and was amplified using the MessageAmp II aRNA Amplification Kit (Ambion) with the following modifications ...
-
bioRxiv - Molecular Biology 2023Quote: ... Sf9 cells were cultured in Sf-900TM II SFM medium (Gibco) and maintained at 27°C and 90 rpm.
-
bioRxiv - Molecular Biology 2023Quote: ... Superscript II RNase H- system and Oligo dT (Invitrogen, CA, USA) were used to reverse transcribe the mRNA to cDNA ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and counted using a hemacytometer or cell counter (Countess II, ThermoFisher). The percentage of cells expressing GFP was determined using flow cytometry (Accuri C6 ...
-
bioRxiv - Plant Biology 2023Quote: ... using the Gateway®LR Clonase™II Enzyme Mix (Invitrogen). Details of all plasmids are available in Supplementary Data 17 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 0.4 ul of Phire Hot Start II DNA Polymerase (Thermo Scientific), and 10 ng of gDNA ...
-
bioRxiv - Genomics 2023Quote: ... and Superscript II reverse transcriptase (1µL, 200 units/µL, Invitrogen, France) was added to the denatured RNA solution (final volume reaction of 72.5μL ...
-
bioRxiv - Genomics 2023Quote: ... and Superscript II reverse transcriptase (1µL, 200 units/µL, Invitrogen, France) was added to the denatured RNA solution (final volume reaction of 18μL ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 0.4 ul of Phire Hot Start II DNA Polymerase (Thermo Scientific), and 10 ng of cDNA ...
-
bioRxiv - Immunology 2023Quote: ... minced and dissociated in collagenase solution (1.5mg/ml collagenase II (Gibco), 0.5mg/ml dispase and 1%FBS in RPMI ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were counted with the automated cell counter - countess II (ThermoFisher) and all re-platted at the same density.
-
bioRxiv - Immunology 2023Quote: ... LR reactions using LR Clonase II Enzyme mix kit (Thermo Fisher) were used ...