Labshake search
Citations for Thermo Fisher :
7551 - 7600 of 10000+ citations for Aldosterone Chemiluminescent ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... Samples were loaded onto an Acclaim PepMap 100 C18 trapping column (300 μm i.d. × 5 mm length, 5 μm particle size, 100 Å pore size; Thermo Fisher Scientific) from the UltiMate 3000 autosampler with 0.1% aqueous formic acid for 3 minutes at a flow rate of 10 μL/min ...
-
bioRxiv - Neuroscience 2022Quote: ... The peptides were loaded on a reverse-phase PepMap 100 C18 μ-precolumn (5 μm, 100 Å, 300 μm i.d. × 5 mm, Thermo Fisher) and then resolved on a nanoscale PepMap 100 C18 nanoLC column (3 μm ...
-
bioRxiv - Microbiology 2022Quote: ... counted with a haemocytometer to a concentration of 5 × 10^5 cells/mL and seeded into 96-well microplate (Nunc, Thermo Scientific).
-
bioRxiv - Molecular Biology 2022Quote: ... Peptides were loaded onto a trap column (PepMap Acclaim C18, 5 mm × 300 μm ID, 5 μm particles, 100 Åpore size, Thermo Fisher Scientific) at a flow rate of 25 μl/min using 0.1% TFA as mobile phase ...
-
bioRxiv - Cancer Biology 2022Quote: ... Peptides were first trapped on a C18 precolumn (Acclaim PepMap 100, 300 μm × 5 mm, 5 μm, 100 Å) (Thermo Fisher Scientific) and eluted peptides were subsequently separated on a μPAC 50 column (PharmaFluidics ...
-
bioRxiv - Cell Biology 2022Quote: ... and resuspended in 5% formic acid and 5% acetonitrile for analysis by LC/MS-MS on an Orbitrap Fusion mass spectrometer (Thermo Fisher Scientific) coupled to a Proxeon EASY-nLC II liquid chromatography (LC ...
-
bioRxiv - Cell Biology 2022Quote: ... using primary antibodies diluted in blocking solution (VE-Cadherin, #14-1441-82, 5 μg/ml final and HES1, #PA5-28802, 5 μg/ml final, Thermo Fisher Scientific) for 48h at 4°C ...
-
bioRxiv - Immunology 2022Quote: ... targeting SAMHD1 (sense RNA 5’-GCAGAUAAGUGAACGAGAUTT-3’, antisense RNA 5’-AUCUCGUUCACUUAUCUGCAG-3’) or the negative control #1 siRNA using RNAiMAX (ThermoFisher, 13778-075). 24 h after transfection ...
-
bioRxiv - Physiology 2022Quote: ... The ventricles were dissected into 3-mm2 columns and shaken at 800 rpm for 90–120 min at 30°C with 750 µL digestion buffer (12.5 µM CaCl2, 5 mg/mL collagenase type II [Thermo Fisher Scientific Inc., Waltham, MA, USA], 5 mg/mL collagenase type IV [Thermo Fisher Scientific Inc.] ...
-
bioRxiv - Microbiology 2022Quote: ... The 16S rRNA gene was amplified with the primers 8f (5′-AGAGTTTGATCCTGGCTCAG-3′; Weisburg et al. 1991) and 1520 r (5′-AAGGAGGTGATCCAGCCGCA-3′; Edwards et al. 1989) (Invitrogen, CA, USA). A volume of 0.5 μL DNA extract was used for 50 μL PCR reactions containing 2 units Taq DNA polymerase ...
-
bioRxiv - Molecular Biology 2022Quote: ... and incubating at 37°C in a 5% CO2 humidified incubator in DFGM supplemented with 5 ng mL−1 TGF-β1 (Thermo Fisher Scientific) and 100 μg mL−1 ascorbic acid ...
-
bioRxiv - Plant Biology 2022Quote: ... Peptides were desalted and concentrated on a PepMap100 trap column (300 µM i.d. x 5 mm, 5 µm C18, 100 Å µ-Precolumn, Thermo Scientific) at a flow rate of 10 µL min-1 ...
-
bioRxiv - Neuroscience 2022Quote: ... the samples were spun down at 300g for 5 min at room temperature and resuspended in 5 mL of NeuroBasal-A medium (Gibco, 10888-022) with 1% penicillin-streptomycin-glutamine (Gibco ...
-
bioRxiv - Neuroscience 2022Quote: ... The ΔK280 deletion was introduced into the expression plasmids by site-directed mutagenesis using phosphorylated primers (5’AAGCTGGATCTTAGCAACGTC and 5’ATTAATTATCTGCACCTTCCCGCC) with Platinum SuperFi DNA Polymerase (ThermoFisher Scientific, USA). The phosphoblocking tau mutant (Tau352Ala ...
-
bioRxiv - Developmental Biology 2022Quote: ... All other lines were passaged at approximately 80% confluency (every 4-5 days on average) as tiny clusters (3-5 cells on average) using 0.5 mM EDTA (15575020, Gibco, concentration 10 mM).
-
bioRxiv - Microbiology 2024Quote: ... each culture was diluted 1:1000 in BHI + 5% yeast and 10μl were streaked on a BHI + 5% yeast agar (Thermo Fisher Scientific, CM1136) plate ...
-
bioRxiv - Neuroscience 2024Quote: ... Protein samples were concentrated on a trap column (PepMap C18, 5 mm x 300 μm x 5 μm, 100Ǻ, Thermo Fisher Scientific) with 2:98 (v/v ...
-
bioRxiv - Neuroscience 2024Quote: ... Nine volumes of brain homogenate were mixed with one volume of 10X detergent buffer [5% (w/v) sodium deoxycholate and 5% (v/v) Nonidet P-40 in PBS] containing Pierce Universal Nuclease (ThermoFisher Scientific #88701) and Halt Phosphatase Inhibitor (ThermoFisher Scientific #78420) ...
-
bioRxiv - Genomics 2024Quote: Human dermal fibroblasts (ATCC PCS-201-010) were maintained at 37°C with 5% CO2 and 5% O2 using low glucose DMEM (ThermoFisher 11885-084) enriched with 15% FBS (GenClone 25-550 ...
-
bioRxiv - Microbiology 2024Quote: ... was added at a 1:2000 dilutions for 1 h at 37 °C, followed by adding TMB (3, 3, 5, 5′-tetramethylbenzidine) peroxidase substrate (Thermo Fisher Scientific) for 30 min ...
-
bioRxiv - Microbiology 2024Quote: ... Purified cDNA was amplified for 25 cycles with VSG specific primers: a spliced-leader (5’-ACAGTTTCTGTACTATATTG-3’) and SP6-VSG 14-mer (5’-GATTTAGGTGACACTATAGTGTTAAAATATATC-3’) using Phusion polymerase (Thermo Scientific, F530L) (annealing temp 55C ...
-
bioRxiv - Microbiology 2024Quote: ... 2uL of RNase-treated cDNA was amplified for 35 cycles with VSG specific primers: a spliced-leader (5’-ACAGTTTCTGTACTATATTG-3’) and SP6-VSG 14-mer (5’-GATTTAGGTGACACTATAGTGTTAAAATATATC-3’) using Phusion polymerase (Thermo Fisher, F530L) (annealing temp 55C ...
-
bioRxiv - Immunology 2024Quote: Analysis of cytokines and chemokines from sera and lungs homogenates collected 5 dpi and 5 dpc were conducted using the ProcartaPlex TM Mouse Cytokine & Chemokine Convenience Panel 1 26-plex (Thermo Fisher Scientific) following the manufacturer’s specifications ...
-
bioRxiv - Cell Biology 2023Quote: ... All drug treatments were performed for 3 – 5 hours prior to imaging with a final concentration of 5 nM of actinomycin D (Gibco, 11805-017) or 1 µM of BMH-21 (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2023Quote: ... Samples were loaded onto an RP C18 pre-column (Acclaim PepMap, 300 μm × 5 mm, 5 μm, 100 Å, Thermo Fisher Scientific) and washed with 0.1% (v/v ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 µl of peptides solution was injected and concentrated on a µ-Precolumn Cartridge Acclaim PepMap 100 C18 (i.d. 5 mm, 5 mm, 100 A°, Thermo Fisher Scientific) at a flow rate of 10 mL/min and using solvent containing H2O/ACN/TFA 98%/2%/0.1% ...
-
bioRxiv - Systems Biology 2023Quote: ... Cells were again washed 3x with 1 mL DPBS for 5 min each followed by nuclear labeling for 5 min with 1 mL 300 nM DAPI dissolved in DPBS (Thermo Fisher Scientific) and a 5-min DPBS wash ...
-
bioRxiv - Cell Biology 2023Quote: ... an equivalent of 1 µg total protein starting material was injected using the µL-pickup method with 0.1% v/v formic acid as a transport liquid from a cooled autosampler (5 °C) and loaded onto a trap column (µPrecolumn cartridge, Acclaim PepMap100 C18, 5 µm, 100 Å, 300 µmx5 mm, Thermo Scientific). Peptides were separated on the nano-LC column using a linear gradient from 2-30% v/v acetonitrile plus 0.1% v/v formic acid in 75 min at a flow rate of 300 nL/min ...
-
bioRxiv - Developmental Biology 2023Quote: ... Extended culture up to day 10 was obtained upon extracellular matrix supplementation in IVC2 media starting from 5 dpa with 5% Geltrex (Thermo Fisher Scientific).
-
bioRxiv - Neuroscience 2023Quote: ... The tissue was then washed in PBS (5 x 5 min) and placed into a DAPI stain solution (300 nM in PBS, D3571, RRID: AB_2307445; ThermoFisher Scientific, Portsmouth, NH) for 10 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were washed four more times in 0.1 M PBS with 0.5% Triton X-100 for 5-10 minutes and then mounted on glass slides using Fluoromount-G with DAPI (Thermo Fisher Scientific). Individual sections were imaged using a slide scanner (Olympus ...
-
bioRxiv - Plant Biology 2023Quote: ... were loaded on a trap column (C18, Acclaim PepMap 100, 300 μM × 5 mm, 5-μm particle size, 100-Å pore size; Thermo Scientific) at a flow rate of 10 µl/min for 3 min using 2% (v/v ...
-
bioRxiv - Biochemistry 2023Quote: ... Digests were concentrated for 4min onto a trapping guard column (PepMap C18, 5 mm x 300 µm x 5 µm, 100Ǻ, Thermo Fisher Scientific). Then ...
-
bioRxiv - Cell Biology 2023Quote: ... Approximately 1 μg of the sample was loaded onto a micro-precolumn (C18 PepMap 100, 300 μm i.d. × 5 mm, 5 μm particle size, 100 Å pore size, Thermo Fisher Scientific) with the sample loading solution for 3 min ...
-
bioRxiv - Plant Biology 2024Quote: ... 5 mM EDTA, 5 mM DTT, 10 mM β-mercaptoethanol, 1% SDS, 1 mM PMSF, and 1X protease inhibitors from Thermo Fisher), and the plant debris was removed by centrifugation ...
-
bioRxiv - Cell Biology 2024Quote: ... For SNX5 and SNX6 the following siRNA sequences were used: SNX5 (5′-UUAGUUUCAGCCCGAAGCAUC-3’), SNX6 (5′-UUAUGAGGUAGACGACUAAAU-3’) (Wassmer et al., 2007), VPS35 (ID 132357, AM16708) (Predesigned – Thermo Fisher Scientific). Nontargeting control siRNA (control ...
-
bioRxiv - Cell Biology 2024Quote: ... gene knock-in was achieved via electroporation of RNP complexes and various DNA donor templates (unmodified, 5’ Biotin, 5’ AmC6, or dbDNA) using the Neon Transfection System (Thermo Fisher Scientific) following the manufacturer’s guidelines ...
-
bioRxiv - Biochemistry 2024Quote: ... Peptides were loaded onto a trap column (PepMap Acclaim C18, 5 mm × 300 μm ID, 5 μm, 100 Å, Thermo Fisher Scientific) with loading buffer (100% water ...
-
bioRxiv - Biochemistry 2024Quote: ... Peptides were loaded onto a trap column (PepMap Acclaim C18, 5 mm × 300 μm ID, 5 μm, 100 Å, Thermo Fisher Scientific) with loading buffer (100% water ...
-
bioRxiv - Biochemistry 2024Quote: ... Peptides were loaded onto a trap column (PepMap Acclaim C18, 5 mm × 300 μm ID, 5 μm, 100 Å, Thermo Fisher Scientific) with loading buffer (100% water ...
-
bioRxiv - Biochemistry 2024Quote: ... Peptides were loaded onto a trap column (PepMap Acclaim C18, 5 mm × 300 μm ID, 5 μm, 100 Å, Thermo Fisher Scientific) with loading buffer (100% water ...
-
bioRxiv - Microbiology 2020Quote: ... 4 μl of 5 mg/ml linear acrylamide (Ambion), 600 μl of preheated (65°C ...
-
bioRxiv - Biophysics 2021Quote: ... with 5% fetal bovine serum (Fisher Scientific, Ottawa, Canada), and 1% penicillin and streptomycin (Invitrogen Canada Inc.) ...
-
bioRxiv - Biophysics 2021Quote: ... Then 2 equivalents of fluorescein-5-maleimide (Invitrogen, #F150) was added and the mixture was incubated at room temperature for 20 min ...
-
bioRxiv - Developmental Biology 2021Quote: Pregnant dams received EdU (5-ethynyl-20-deoxyuridine, Invitrogen) dissolved in PBS by intraperitoneal injection (50 mg/kg ...
-
bioRxiv - Cell Biology 2020Quote: ... Sections were pre-incubated with 5% goat serum (Invitrogen) in PBS for 1hr ...
-
bioRxiv - Cell Biology 2020Quote: ... and Y14 siRNA (5’-GGGUAUACUCUAGUUGAAUUUCAUAUUCAACUAGAG-3’) with Lipo2000 (Invitrogen) in Optimem (Gibco) ...
-
bioRxiv - Cell Biology 2020Quote: ... Neutrophils were labeled with 5 μM CellTracker (CFMDA; ThermoFisher) for 10 minutes at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... 0.5 mM MgSO4 and 5 µL TURBO DNase (Ambion). Subsequently ...
-
bioRxiv - Microbiology 2019Quote: ... Orion 5 Star Meter (Thermo Fisher Scientific, Waltham, MA) was used to measure temperature ...