Labshake search
Citations for Thermo Fisher :
7401 - 7450 of 10000+ citations for Aldosterone Chemiluminescent ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... grown on LB plates with 100 μM Ampicilin (ThermoFisher Scientific, USA). Plasmids were purified (BioBasic ...
-
bioRxiv - Microbiology 2024Quote: ... Cells were seeded in 24-well tissue culture treated plates (Nunc) at the following densities ...
-
bioRxiv - Neuroscience 2024Quote: ... coated plates and passaged using 0.5mM EDTA (Thermo Fisher Scientific, #15575020). Cerebral organoids were generated using a modified organoid differentiation protocol17 ...
-
bioRxiv - Cell Biology 2024Quote: ... and plated in domes in a 24-well plate (ThermoFisher #142475). After 10 minutes of incubation at 37°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... the plates were fixed using 10% formalin (Fisher Scientific SF98-4) and stained with crystal violet ...
-
bioRxiv - Immunology 2024Quote: ... were then stimulated with plate-bound anti-CD3 (clone 17A2, Invitrogen) and anti-CD28 (clone 37.51 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and plates were sealed using clear adhesive film (Fisher Scientific #15963620). The plates were then incubated at 37°C and optical density at 600nm measured every 5 minutes in a BMG Clariostar Plus ...
-
bioRxiv - Immunology 2024Quote: ... cells were plated on nunc round bottom 96-well plates (Thermofisher) for staining.
-
bioRxiv - Genetics 2024Quote: ... and the homozygote variant iPSCs were grown in a feeder-free manner on Matrigel (Corning)-coated 6-well plates in Essential 8 (E8) medium (ThermoFisher Scientific). Media was changed daily ...
-
bioRxiv - Neuroscience 2024Quote: ... spheroids were transferred to untreated plates (cat #LBS60001X, Thermo Fisher Scientific) onto the orbital shaker (cat #NB-T101SRC ...
-
bioRxiv - Developmental Biology 2021Quote: ... PCR was performed on lysates to amplify the genomic region targeted by the sgB with primers forward 5’GGGTGTTGTTCAGCGATGGA and reverse 5’ATAGATCTCATTGTGATCGA using Phusion High-Fidelity DNA polymerase (Thermo Scientific). The amplicons were cloned in pCR-bluntII-TOPO vector (Zero Blunt Topo PCR cloning kit ...
-
bioRxiv - Developmental Biology 2021Quote: ... The amplicon of the-2.3etv2 promoter was synthesised from zebrafish genomic DNA with a forward primer 5’- TATAGGGCGAATTGggtaccTTCAGTAAGCAGACTCCTTCAATCA -3’ and a reverse primer 5’- AGCTGGAGCTCCAccgcggTTCGGCATACTGCTGTTGGAC -3’ by Phusion High-Fidelity DNA Polymerase (Thermo Scientific) as an insert for In-Fusion Cloning (Takara Bio ...
-
bioRxiv - Biochemistry 2020Quote: ... Samples were loaded onto a C18 AcclaimTM PepMapTM trap column (100 Å, 5 μm × 0.3 mm × 5 mm, Thermo Fisher Scientific) and washed for 3 min at 30 μL/min before peptides were eluted onto a C18 AcclaimTM PepMapTM column (100 Å ...
-
bioRxiv - Microbiology 2022Quote: ... The region of recombination (VP1 to 2C) was amplified using primers PV3-F (5′-GCAAACATCTTCCAACCCGTCC-3′) and PV1-R (5′-TTGCTCTTGAACTGTATGTAGTTG-3′) and Taq polymerase (Life Technologies) with an initial denaturing at 94°C for 3 min ...
-
bioRxiv - Microbiology 2022Quote: ... 16S rRNA gene was amplified using primers 8F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-GGTTACCTTGTTACGACTT-3’) by colony PCR (Vaishnava et al., 2011) using DreamTaq Master Mix (ThermoFisher Scientific) and 0.2μM primers ...
-
Targeted rescue of synaptic plasticity improves cognitive decline after severe systemic inflammationbioRxiv - Neuroscience 2021Quote: ... using the oligonucleotides WPRE-F 5’-TGCTTCCCGTATGGCTTTCAT-3’ and WPRE-R 5’-CAGCAAACACAGTGCACACC-3’ as primers and SYBR Select Master Mix (ThermoFisher Scientific). The measurements were performed with a CFX384 instrument (Biorad ...
-
bioRxiv - Molecular Biology 2021Quote: ... synthetic EMCV RNA variants (Table 5) were dissolved in distilled water and labelled at the 5’ end with Dylight 650 maleimide conjugates (Thermo Scientific) using the 5′ EndTag kit (Vector Labs ...
-
bioRxiv - Immunology 2021Quote: ... was added as the secondary antibody at a 1:2000 dilution for 1 h at 37C, followed by adding TMB (3, 3, 5, 5’-tetramethylbenzidine) peroxidase substrate (Thermo Scientific) for about 15 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... and diluted to 30 pg/μl concentration in 5 mM Tris-HCl (pH 7.5) supplemented with 5 ng/µl carrier herring sperm (Thermo Fisher Scientific). The MSI assay was performed using single-molecule PCR (SM-PCR ...
-
bioRxiv - Molecular Biology 2019Quote: ... 0.5 µg of RNA was heated for 5 min to 65°C and cDNA was generated using SuperScript III (Life Technologies) and random primers for 1 h at 50°C followed by heat inactivation for 15 min at 70°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the following primers c=myb-F 5’-CCAAGTCAGGAAAACGCCACCTCG-3’ and c-myb-R 5’-GCTGTTGTTTAGCGGAGTTGGGCT-3’ and cloned into the dual promoter vector pCRII-TOPO (Life Technologies). The pCS2:runx1 probe was a gift from Leonard Zon ...
-
bioRxiv - Biophysics 2019Quote: Peptide digests were dried by vacuum centrifugation and dissolved in 20 µl of 5% formic acid and injected at a flow rate of 5 μl/min onto an Acclaim PepMap 100 μm × 2 cm NanoViper 5-μm C18 trap (Thermo Scientific) using mobile phase A containing water and 0.1% formic acid ...
-
bioRxiv - Synthetic Biology 2019Quote: ... × 5 mm 5 µm 100 Å and an Acclaim PepMap RSLC 75 µm × 25 cm 2 µm 100 Å (Thermo Scientific). The columns were installed on an Ultimate 3000 RSLCnano system (Dionex) ...
-
bioRxiv - Genomics 2020Quote: ... using forward primer (5’-TGATTATCGACATCCCGTCA-3’) and reverse primer (5’-GTCTGGAATCTCATAGGTAG-3’) and run on an ABI 7500 thermocycler (Applied Biosystems). Primer specificity and capture temperature were determined by melt curve analysis ...
-
bioRxiv - Neuroscience 2020Quote: Genomic DNA in the vicinity of the rs7143400 was amplified by PCR using the following primers 5’-GGTTGGGTGTGAATAGGAAT-3’ and 5’-TGCATGCCTGATTTATTTGG-3’ before digestion with Tsp45I enzyme (Thermo Scientific). Finally ...
-
bioRxiv - Molecular Biology 2021Quote: ... Analysis of global levels of 5-mdC and 5-hmdC were performed on a Q exactive mass spectrometer (Thermo Fisher Scientific). It was equipped with an electrospray ionization source (H-ESI II Probe ...
-
bioRxiv - Biochemistry 2021Quote: ... Approximately 1 μg of peptides were desalted on a trap column (Acclaim PepMap100 C18, 5 μm, 100 Å, 300 μm i.d. × 5 mm, Thermo Scientific) and then separated on an in-house packed column (75 μm i.d ...
-
bioRxiv - Cell Biology 2021Quote: ... and resuspended into 5 mL of warm PBS containing 5 μg mL−1 Hoechst 33342 (Thermo Fisher Scientific, Waltham, MA, USA) to stain live leukocytes.
-
bioRxiv - Microbiology 2020Quote: Experiments to determine the sensitivity of the two RT-qPCR methods and nested PCR were completed using serial dilutions of each transcript (5*103 to 10−1 copies/5 µL) in a previously described RNA storage buffer containing RNA storage solution (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... Resulting colonies were screened for plasmid presence by PCR of a portion of the pESC-URA-lpt1 plasmid (Forward primer: 5’-TTGGAAACAGCTCCAAATCC-3’, Reverse primer: 5’ CCCAAAACCTTCTCAAGCAA-3’; ordered from ThermoFisher Oligos) and preserved as glycerol stocks.
-
bioRxiv - Microbiology 2021Quote: ... mixed with forward and reverse detection primers (T3DCD S1 forward [5’- TACGCGTTGATCACGACAAT-3’] and T3DCD S1 reverse [5’- TGGCGAGATTATTCCCTGAC-3’] or GAPDH forward [5’- ACCCAGAAGACTGTGGATGG-3’] and GAPDH reverse [5’- GGATGCAGGGATGATGTTCT-3’]) and SYBR Select Master Mix (Applied Biosystems), and then subjected to PCR using the StepOnePlus Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Microbiology 2020Quote: Parasites after treatment were washed in 5 mL complete medium at 400 g for 3 min and stained with 5 μM JC-1 (ThermoFisher Scientific) in complete medium in the dark at 37 °C for 30 min ...
-
bioRxiv - Cell Biology 2021Quote: ... the Peptides were trapped for 10 min on a precolumn (Acclaim PepMap100, C18, 5 μm, 100 Å, 300 μm i.d. × 5 mm, Thermo Scientific) and subsequently separated using an analytical column (Easyspray 50 cm column (ES803 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 800 ng of digests were loaded in random order onto a pre-column (C18 PepMap 100, 5 µm, 100 A, 300 µm i.d. x 5 mm length, Thermo Fisher, 160454) at a flow rate of 50 µL/min with solvent C (0.05% TFA in water/acetonitrile 98:2).
-
bioRxiv - Neuroscience 2020Quote: ... then four times in PBS for 5 minutes (5 minutes for each wash) before mounting with Floromount G (Thermo Fisher Scientific). Slices were imaged an Olympus VS120 slide scanning microscope ...
-
bioRxiv - Developmental Biology 2022Quote: ... were retrotranscribed from either 5’-CATGCTGCTGGTGGGTGTGCT-3’ or 5’-CCATAAAGCACCGGTGAGCAGAA-3’ endoglin specific reverse oligonucleotides (500 nM) using RevertAid H minus reverse Transcriptase (Thermo Scientific) 10 U/μl in 1X RevertAid H minus Buffer supplemented with 2 U/μl RNAse OUT (Thermo Scientific) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Embryos were then washed twice for 5 min each in PBS and subsequently incubated with 5 µg/ml Hoechst 33342 (Invitrogen, USA) in PBS for 5 min to stain the nuclei ...
-
bioRxiv - Microbiology 2022Quote: ... 2.5 x 107, or 5 x 107 PFU/mL (MOI of 5, 50, or 100 respectively) in CO2-independent medium (Gibco Life Technologies) supplemented with 0.1% (w/v ...
-
bioRxiv - Biophysics 2022Quote: ... and SN25 FL (1–206, R59C) or truncation mutant (11–206, R59C) were labeled with 5×molar excess Tetramethylrhodamine-5-maleimide (TMR) (Molecular Probes) in 25 mM HEPES pH 7.4 ...
-
bioRxiv - Cell Biology 2022Quote: ... Peptides were loaded onto a μ-precolumn (Acclaim PepMap 100 C18, cartridge, 300 μm i.d.×5 mm, 5 μm) (Thermo Scientific), and were separated on a 50 cm reversed-phase liquid chromatographic column (0.075 mm ID ...
-
bioRxiv - Developmental Biology 2021Quote: ... Tryptic peptide mixtures were injected automatically and loaded at a flow rate of 30 μl/min in 0.1% trifluoroacetic acid in HPLC-grade water onto a nano trap column (300 μm i.d. × 5 mm Pre column, packed with Acclaim PepMap100 C18, 5 μm, 100 Å; Thermo Scientific). After 3 minutes ...
-
bioRxiv - Neuroscience 2021Quote: The successfully reprogrammed hiPSCs were incubated in hypoxic conditions (5% CO2, 5% O2) at 37°C and maintained in StemFlex™ media (Gibco) on 6-well NUNC™ plates (ThermoFisher ...
-
bioRxiv - Microbiology 2020Quote: ... using the ZIKV-F2 (5’-CAGCTGGCATCATGAAGAATC-3’) and ZIKV-R1 (5’-CACTTGTCCCATC TTCTTCTCC-3’) primers for African strain detection (ThermoFisher SCIENTIFIC) or the ZIKV-F1 (5’-CAGCTGGCATCATGAAGAACC-3’ ...
-
bioRxiv - Biochemistry 2020Quote: ... Acclaim™ PepMap™ 100 C18 LC Column (5 mm x 0.3 mm i.d., 5 μm, 100 Å, Thermo Fisher Scientific) was used as trap column at a flow rate of 25 μL min-1 kept at 45 °C ...
-
bioRxiv - Physiology 2022Quote: ... washed once with cold acetone and then dissolved in Laemmli buffer (Tris 10 mM pH 7.5, EDTA 1 mM [Fluka, Buchs, Switzerland], β-mercaptoethanol 5%, SDS 5%, glycerol 10% [ThermoFisher Scientific]). Sonication and centrifugation were repeated as above to pellet and eliminate possibly remaining cell debris ...
-
bioRxiv - Neuroscience 2022Quote: ... Quantitative RT-PCR on the mouse Zdhhc17 gene using primers spanning exons 1 and 2 (5’-ACCCGGAGGAAATCAAACCACAGA-3’ and 5’-TACATCGTAACCCGCTTCCACCAA-3’) and Sso/Advanced Universal SYBR green supermix (Fisher Scientific) was performed on CFX96 Real Time System (C1000 Touch Thermal Cycler ...
-
bioRxiv - Molecular Biology 2022Quote: ... sgRNA sequences cutting near genomic loci of MLL3 Y4792 (5’-ACTATGGTCATCGAGTACAT-3’) and MLL4 Y5477 (5’-ACGATGGTCATCGAGTACAT-3’) were synthesized by Thermo Fisher’s custom in vitro transcription service ...
-
bioRxiv - Cell Biology 2022Quote: Bladders of 5 young and 5 aged mice were collected and homogenized in TRIzol™ Reagent (15596026, Thermo Fisher Scientific, USA) to extract total RNA followed by DNase 1 treatment (18068-015 ...
-
bioRxiv - Molecular Biology 2019Quote: HeLa cells grown on poly-L-lysine–coated coverslips were incubated in 5% CO2 at 37°C for 1 h with 5 µM MitoTracker Red CMXRos (Molecular Probes) in DMEM ...
-
bioRxiv - Genetics 2019Quote: ... resuspended in 60 ml hypotonic lysis buffer (20 mM HEPES-KOH pH 7.5, 5 mM NaCl, 1 mM MgCl2, 1 mM PMSF and EDTA free protease inhibitor mixture from Roche and Thermo Scientific) and incubated for 15 min on ice ...