Labshake search
Citations for Thermo Fisher :
7451 - 7500 of 10000+ citations for Aldosterone Chemiluminescent ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2019Quote: ... 20 mg/mL BSA (12 µl) and 5 Weiss U/µl T4 DNA ligase (5 µl in two instalments; Thermo Fisher) by incubating 4 h at 20°C with gentle rotation ...
-
bioRxiv - Pathology 2021Quote: ... Each paraffin-embedded tissue was sequentially sectioned at 5 μm thickness into 5 consecutive sections and were mounted on HistoGrip (Invitrogen, US) coated glass slides ...
-
bioRxiv - Plant Biology 2021Quote: The IKU2 promoter was amplified using the primers Prom-IKU2-B4 (5’-ggggacaactttgtatagaaaagttgGGTCTCTCTTGATAACGATTTG-3’) and Prom-IKU2-B1R (5’-ggggactgcttttttgtacaaacttgTGTTCTCTACGTCGGAAGG- 3’) and cloned into pDONR-P4-P1R (Life Technologies). A triple LR Gateway reaction (Life Technologies ...
-
bioRxiv - Developmental Biology 2020Quote: ... PCR was done on1 uL of cDNA using 10 µM of forward and reverse primers (Fw 5’-AAGATTCTCCTGAGCTGGGTC −3’ and Rv 5’-AGTCACTTTAGGTGGCCTTGG −3’, Life technologies) and 1 U Taq DNA polymerase (10342 ...
-
bioRxiv - Immunology 2020Quote: ... or equimolar mix of two human APOBEC3A siRNAs (Silencer 45715 and 45810, respectively, with sense sequences 5’-GACCUACCUGUGCUACGAATT-3’ and 5’-GCAGUAUGCUCCCGAUCAATT-3’, Life Technologies) using Lipofectamine RNAiMAX (Life Technologies) ...
-
bioRxiv - Cell Biology 2020Quote: Dried fractions were resuspended in 8 μL 5% ACN + 5% FA and analyzed on an Orbitrap Fusion with in-line Easy Nano-LC 1000 (Thermo Scientific). Fractions were run as 3 h gradients progressing from 3% ACN + 0.125% FA to 100% ACN + 0.125% FA ...
-
bioRxiv - Biochemistry 2021Quote: ... and subsequently a copy of chromosome XV was removed by counter-selection against the URA3 gene by replica-plating on SD medium containing 1 mg/mL 5-fluoroorotic acid (5-FOA, ThermoFisher Scientific) from a 100 mg/mL stock in DMSO ...
-
bioRxiv - Neuroscience 2021Quote: ... or with a pool of two different USP30 siRNAs (D1: 5’-CAAAUUACCTGCCGCACAA-3’; D3, 5’-ACAGGAUGCUCACGAAUUA-3’, Dharmacon; siUSP30) by using Lipofectamine RNAiMAX (Thermo Scientific) following the manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2021Quote: ... and human Oct 4 (For: 5’-CTTGCTGCAGAAGTGGGTGGAGGAA-3’/Rev: 5’-CTGCAGTGTGGGTTTCGGGCA-3’) PCRs were conducted using an ABI 7300 Real Time PCR System (Applied Biosystems). PCR cycling conditions were 95° C for 10 min. ...
-
bioRxiv - Cancer Biology 2021Quote: ... The synthesized cDNA was amplified by EBNA 3C (1F and 1R) primers (5’-GAGAAGGGGAGC GTGTGTTGT-3’, 5’-GCTCGTTTTTGACGTCGGC-3’) by using regular PCR and adding Taq DNA polymerase (ThermoFisher, USA). The components of 25 μL reaction mixture contained 10 μL extracted DNA ...
-
bioRxiv - Immunology 2021Quote: ... against the IAV nucleoprotein (forward: 5’-CAGCCTAATCAGACCAAATG-3’; reverse: 5’-TACCTGCTTCTCAGTTCAAG-3’) were assayed using SYBR Green Master Mix (Applied Biosystems) to confirm viral presence in the maternal lung.
-
The skin environment controls local dendritic cell differentiation and function through innate IL-13bioRxiv - Immunology 2021Quote: ... FW 5’-CTCTCTGGGCGAAATCTGCT-3’ and REV 5’-GAGTGCTTTCGCTATGTTGTTCA-3’ for Clmn and FW 5’-TGATGGGTGTGAACCACGAG-3’ and REV 5’-GCCGTATTCATTGTCATACCAGG-3’ for Gapdh using a QuantStudio 7 (Applied Biosystems). Transcript levels are expressed as the ratio of 2−ΔCT (Transcript of interest)/2−ΔCT (Gapdh).
-
bioRxiv - Genetics 2020Quote: ... mouse cDNA was amplified with primers (F: 5-gtttatgggcctcaacctcatg-3, R: 5-caggcttcactccagctttttgg-3) and then enzyme digested with BsiEI (Thermofisher #FD0894). Genotyping result using this method is shown in Fig ...
-
bioRxiv - Microbiology 2022Quote: ... counted with a haemocytometer to a concentration of 5 × 10^5 cells/mL and seeded into 96-well microplate (Nunc, Thermo Scientific).
-
bioRxiv - Cell Biology 2022Quote: ... The peptides were first trapped for 1 min at 30 μl/min with 100% buffer A on a trap (0.3 mm by 5 mm with PepMap C18, 5 μm, 100 Å; ThermoFisher Scientific); after trapping ...
-
bioRxiv - Microbiology 2022Quote: ... The barcode region was amplified from the isolated DNA using forward (5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCATCATGAACAATAAAACT GTCTGC3’) and reverse (5’GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGA CGATGACGGGCTGGTC3’) primers using Phusion high fidelity polymerase (ThermoFisher Scientific) for 20 cycles ...
-
bioRxiv - Neuroscience 2022Quote: ... Tryptic peptide mixtures were injected automatically and loaded at a flow rate of 30 μl/min in 0.1 % trifluoroacetic acid in HPLC-grade water onto a nano trap column (300 μm i.d. × 5 mm Pre collumn, packed with Acclaim PepMap100 C18, 5 μm, 100 Å; Thermo Scientific). After 3 minutes ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Cell Biology 2022Quote: Dictyostelium discoideum cells were maintained in Hans’ enriched HL-5 media (1.4X HL-5 media with 8% FM, penicillin and streptomycin) at 22°C in petri dishes (Fisher Scientific; FB0875712). A full list of strains used in this study can be found in Appendix Table S3.
-
bioRxiv - Cell Biology 2024Quote: ... 0.1% [v/v] TFA and injected onto a C18 Pep-Map100-trapping column (Thermo Scientific, 0.3 x 5 mm, 5 μm) connected to an in-house packed C18 analytical column (Dr Maisch GmbH ...
-
bioRxiv - Cell Biology 2024Quote: ... the antibiotic selection was performed for at least 5 days using expansion media containing 5 µg/ml blasticidin S (Gibco, A1113903). hiPSC-CMs were kept in expansion media for another 2-3 days to allow cell recovery and then cultured in maturation media for at least 21 days before split into matrigel-coated white 96-well plates (Greiner Bio-One ...
-
bioRxiv - Physiology 2024Quote: Coarsely chopped liver fragments from each mouse were digested in 5 ml liberase-based digestion mix (5 ml of DMEM [Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... embryos were manually dechorionated and placed in either 5 mL of egg water (control group) or 5 mL of 40 µM MK-801(Fisher Scientific) in egg water ...
-
bioRxiv - Molecular Biology 2023Quote: ... Dried down protein Samples were further desalted online (PepMAP C18, 300 µm x 5 mm, 5 µm particle, Thermo Fisher Scientific) for 1 min (flow rate of 20 µL/min and separated on an EASY-Spray column ...
-
bioRxiv - Microbiology 2023Quote: Epimastigotes and trypomastigotes lysates containing 2 x 107 parasites in 20 µL of SDS-PAGE sample buffer containing 5 mM DTT were boiled for 5 min and loaded onto precast Novex Value 4-12% Tris-Glycine gels (Thermo Fisher). The electrophoresis was performed in 50 mM MOPS-50 mM Tris Base ...
-
bioRxiv - Cell Biology 2023Quote: ... Peptides were loaded onto a µ-precolumn (Acclaim PepMap 100 C18, cartridge, 300 µm i.d.×5 mm, 5 µm) (Thermo Scientific), and separated on a 50 cm reversed-phase liquid chromatographic column (0.075 mm ID ...
-
bioRxiv - Neuroscience 2023Quote: ... then 5 min in PBS and incubated for 30 min in 5 µg/µl Alexa 647-conjugated bungarotoxin (Thermo Fisher Scientific) dissolved in 1% bovine serum albumin (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2023Quote: ... cDNA was synthesized from 5 μg of total RNA using oligo dT18 primer (5 μM) and SuperScript III (Thermo Scientific 18080044). Quantitative PCR was performed using the gene specific primer sets (Table S2 ...
-
bioRxiv - Biophysics 2022Quote: ... incubated for 5 min with 25 pM (single-label) or 5 pM (dual-label) biotin-tagged α-FLAG monoclonal antibody (ThermoFisher Scientific #MA1-91878-BTIN ...
-
bioRxiv - Molecular Biology 2023Quote: ... or a non-targeting control siRNA (siGENOME Non-Targeting siRNA 5, Horizon Discovery, # D-001210-05-05) and 5 µl Lipofectamine RNAiMAX (Invitrogen, #13778075) in a total volume of 2 ml in antibiotics free 10% DMEM ...
-
bioRxiv - Immunology 2023Quote: ... Spleens were mashed through a 70 μm filter with 5 mL DMEM with 5% FBS and 1% Penicillin/Streptomycin (Life Technologies). Before excising lungs ...
-
bioRxiv - Cancer Biology 2023Quote: ... HeLa Kyoto and RPE1 cells were treated with 5 pmol siRNA that was preincubated for 5-10 minutes in Opti-MEM Reduced Serum Media (Gibco, 31985062) with Lipofectamine RNAiMax Transfection Reagent (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... first onto an Acclaim PepMap100 C18 LC Column (5 mm Å∼ 0.3 mm i.d., 5 μm, 100 Å, Thermo Fisher Scientific) at a flow rate of 10 μL min−1 maintained at 45 °C and then then separated on 50 cm RP-C18 µPAC™ column (PharmaFluidics) ...
-
bioRxiv - Immunology 2023Quote: ... contaminating red blood cells were lysed by resuspending cells for 5 minutes in 5 mL of ice-cold ACK Lysis buffer (Gibco, A1049201). The cells were then pelleted at 500 x g for 5 minutes ...
-
bioRxiv - Biophysics 2023Quote: ... membranes were immediately trimmed and placed in either 5% non-fat milk or 5% BSA in 1X TBS supplemented with 1% Tween (Thermofisher #1706475) (TBST ...
-
bioRxiv - Cell Biology 2024Quote: ... Peptide mixtures were injected onto a C18 trap column (PepMap Neo Trap Cartridge, ID 0.3 mm x 5 mm, particle size 5 μm, Thermo Fisher Scientific) and subsequently fractionated by C18 reverse-phase chromatography (3 μm ...
-
bioRxiv - Cell Biology 2024Quote: ... experiments were grown overnight in SDC at RT and then diluted in SDC and grown at 30°C for >4 h before being treated with either 500 µM 3-indole acetic acid (3-IAA; AID) for 1h or 1 µM estradiol + 1 µM 5-phenyl-IAA (5-Ph-IAA; Fisher Scientific) for 2h (grAID ...
-
bioRxiv - Cell Biology 2024Quote: ... GAPDH-F (5’-GGA GCGAGATCCCTCCAAAAT-3’) and GAPDH-R (5’-GGCTGTTGTCATACTTCTCATGG-3’) using Power SYBR Green PCR Master Mix (Applied Biosystems). All reactions were carried out on the StepOnePlus Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2024Quote: ... or Stealth siRNAs targeting coding sequences of human EZH2 mRNA (5′-GACCACAGUGUUACCAGCAUUUGGA-3′: EZH2 #1, and 5′-GAGCAAAGCUUACACUCCUUUCAUA-3′: EZH2 #2) were obtained from Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: ... Peptides were loaded onto a µ-precolumn (Acclaim PepMap 100 C18, cartridge, 300 µm i.d.×5 mm, 5 µm) (Thermo Scientific), and were separated on a 50 cm reversed-phase liquid chromatographic column (0.075 mm ID ...
-
bioRxiv - Cancer Biology 2024Quote: ... EDTA was added to the samples at a final concentration of 5 mM and the suspension was diluted 1:5 in collection buffer (2 % heat-inactivated fetal bovine serum, Life Technologies; 26140079 ...
-
bioRxiv - Molecular Biology 2024Quote: ... High titer wild-type or mutant Churi was mixed with the culture at MOI of 5 and incubated at 30°C for 20 minutes before adding 5 µM SYTOX Green Nucleic Acid Stain (Thermo Fisher). Next ...
-
bioRxiv - Cell Biology 2024Quote: ... The peptide mixtures were loaded onto a C18 trap column (PepMap Neo Trap Cartridge, ID 0.3 mm x 5 mm, particle size 5 μm, Thermo Fisher Scientific) and fractionated through the C18 analytical column (Aurora ...
-
bioRxiv - Cell Biology 2024Quote: ... Analysis of total 5-methyl-2ʹ-deoxycytidine (5-mdC) concentrations was performed using a Q exactive mass spectrometer (Thermo Fisher Scientific), equipped with an electrospray ionization source (H-ESI II Probe ...
-
bioRxiv - Biochemistry 2024Quote: ... The qRT-PCR reaction with 5 μl cDNA (4ng/μl) and 7.5 μl SYBR®Green PCR Master Mix (5 mL) (Applied Biosystems) was performed on a Bio-Rad CFX connect real-time system (Bio-Rad ...
-
bioRxiv - Genetics 2024Quote: All bacterial strains were grown on Lennox LB Agar (5 g/L NaCl, 10 g/L SELECT Peptone 140, 5 g/L SELECT Yeast Extract) (Invitrogen, 12780029) at 30 °C or 37 °C unless specified otherwise and are listed in Table 3 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 40 μl of solubilized protein lysate was stained with 5 μl of 5% G-250 sample additive (Thermo Fisher Scientific). Wells of a Native-PAGE 3–12% Bis-Tris protein gel were washed with the dark blue cathode buffer ...
-
bioRxiv - Immunology 2019Quote: ... Supernatants were collected following a 48h incubation at 37°C and IFNγ and TNFα levels were measured by ELISA (Thermo Fisher Scientific, Waltham, MA, USA).
-
bioRxiv - Neuroscience 2020Quote: ... Blots were developed using Amersham ECL Prime Western Blotting Detection Reagent (RPN2232) or SuperSignal ELISA Femto Maximum Sensitivity Substrate (Thermo Scientific, Ref: 37075, Lot: UO282555) and the resulting chemiluminescence imaged with an Alpha Innotech MultiImage Light Cabinet (Alpha Innotech ...
-
bioRxiv - Biochemistry 2023Quote: ... and the bound target-Fab complexes were incubated with an HRP-conjugated Pierce recombinant protein L (cat: 32420, Thermofisher, 1:5000 dilution in ELISA buffer) for 30 min ...