Labshake search
Citations for Thermo Fisher :
701 - 750 of 10000+ citations for 5 Methylsulfamoylmethyl 1H indole 3 carboxylic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Hepatitis B Virus genomes associate with cellular sites of DNA damage by inducing replication stressbioRxiv - Microbiology 2024Quote: ... 0.75 μL of 20mM NHS esters (Thermo Scientific) were conjugated to the aminoallyl-tagged oligos for 2 hours in the dark ...
-
bioRxiv - Biochemistry 2023Quote: ... Alexa Fluor 488 succinimidyl ester (ThermoFisher Scientific; A20002), or Alexa Fluor 546 succinimidyl ester (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... DylightTM 594 NHS-ester (Thermo Fisher Scientific, 46412), and Alexa FluorTM 647 carboxylic acid ...
-
bioRxiv - Biophysics 2023Quote: ... Alexa Fluor 568 ester (Molecular Probes, Cat# A20003) or Alexa Fluor 488 ester (Molecular Probes ...
-
bioRxiv - Neuroscience 2023Quote: ... Tetramethylrhodamine ethyl ester (TMRE) was purchased from ThermoFisher; catalog no.T669.
-
bioRxiv - Genomics 2023Quote: ... or Alexa Fluor 488–NHS ester (Invitrogen A20000) as described before17 or directly purchased (Integrated DNA Technologies).
-
bioRxiv - Immunology 2023Quote: ... Pacific OrangeTM Succinimidyl Ester (Life technologies, Lot 2179293) was diluted (1:1000 ...
-
bioRxiv - Microbiology 2023Quote: Lyophilized DyLight550 NHS ester dye (Thermo Fisher Scientific) or JF646 NHS ester dye (Janelia ...
-
bioRxiv - Neuroscience 2023Quote: ... Alexa Fluor 488 Succinimidyl Ester (Invitrogen, Cat# A20000) powder was dissolved separately in internal solution at a concentration of 1 mg/mL ...
-
bioRxiv - Cancer Biology 2023Quote: ... and DL633-NHS ester (Thermo Scientific, Cat#: 46414), at a molar ratio of 1:20 (antibody:fluorophore) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and DyLight680-NHS ester (Thermo Scientific, Cat#46418), at a molar ratio of 1:20 (antibody:fluorophore) ...
-
bioRxiv - Cancer Biology 2024Quote: ... including DyLight488-NHS ester (Thermo Scientific, Cat#: 46402), DyLight550-NHS ester (Thermo Scientific ...
-
bioRxiv - Immunology 2024Quote: ... HAP1 SPPL3-/- cells with AF350 succinimidyl ester (Invitrogen) and HAP1 SPPL3-/-B3GNT5-/- with both according to manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... including Cy3/Cy5/iFluor 488 NHS esters (ThermoFisher) and iFluor 405 NHS ester (AAT Bioquest) ...
-
bioRxiv - Molecular Biology 2024Quote: ... EZ-Link TFP Ester-PEG12-DBCO (Life Technologies), dissolved in DMSO ...
-
bioRxiv - Immunology 2024Quote: ... 100nM Tetramethylrhodamine ethyl ester (TMRE) (#T669, ThermoFisher Scientific) MFI was used as a measure of actively metabolizing mitochondria.
-
bioRxiv - Systems Biology 2024Quote: ... or Alexa Fluor 488– NHS ester (Invitrogen A20000) as described before17,18 or directly purchased (Integrated DNA Technologies).
-
bioRxiv - Cell Biology 2024Quote: ... or Alexa Fluor 488 NHS-ester (Thermo Scientific) as described (Sun et al. ...
-
bioRxiv - Biophysics 2024Quote: ... 2 μM pHrodo succinimidyl ester (Thermo Fisher Scientific), and the appropriate amount of glutaraldehyde for drug experiments ...
-
bioRxiv - Neuroscience 2020Quote: ... 5’-GCCTCCCATCCACAAGAATAGTG-3’ and cloned into pCRII-Blunt-TOPO (Invitrogen). This plasmid was then used to generate digoxigenin-labeled sense and antisense probes.
-
bioRxiv - Immunology 2021Quote: ... ENV probe (5’-/VIC/CCTTGGGTTCTTGGGA-3’/MGB, Thermo Fisher Scientific), Gag forward (5’-ATGTTTTCAGCATTATCAGAAGGA-3’) ...
-
bioRxiv - Immunology 2021Quote: ... Pol probe (5’-/NED/AAGCCAGGAATGGATGGCC-3’/MGB, Thermo Fisher Scientific). Thermostabe DNA polymerase was made in-house by transforming E ...
-
bioRxiv - Molecular Biology 2020Quote: ... a control scrambled RNA (customed, Ambion, sense: 5’-UUCUCCGAACGUGUCACGUtt-3’) was used ...
-
bioRxiv - Cell Biology 2020Quote: ... 3-5 minute incubation with Tryple Express Trypsin (Thermo Fisher), and dilution and gentle trituration in complete media ...
-
bioRxiv - Immunology 2021Quote: ... tetramethylindocarbocyanine perchlorate;CILC18(3) (5 µM/mL DiI, ThermoFisher-Invitrogen) and adoptively transferred intravenously into non-myeloablated Lyve1-GFP+ mice ...
-
bioRxiv - Immunology 2021Quote: ... tetramethylindocarbocyanine perchlorate;CILC18(3) (5 µM/mL DiI, ThermoFisher-Invitrogen) and adoptively transferred intravenously into non-myeloablated Lyve1-GFP+ mice ...
-
bioRxiv - Cell Biology 2020Quote: ... TPD53: 5’-GUCUCCAGCAAUAGGAUGAUUUACUA-3’) with Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... and removed by treatment with 3-5 mL trypsin (Gibco) then pelleted by centrifugation at 300 × g for 10 min ...
-
bioRxiv - Microbiology 2024Quote: ... 5’- UUUCCUUCCACUCGGAUAAGAUGCUGA-3’ were transfected with RNAiMaX (Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... washed 3 x 5 min with PBS (Gibco #14200-067) and fixed with 4 % (w/v ...
-
bioRxiv - Biochemistry 2021Quote: ... and 5-aminolevulinic acid hydrochloride were purchased from Acros Organics (Fair Lawn, NJ). The 11-hydroxylauric and 12-hydroxylauric-d20 acid standards were purchased from Santa Cruz Biotechnology ...
-
bioRxiv - Developmental Biology 2022Quote: ... mixed with an equal volume of 5:1 acid phenol: chloroform (ThermoFisher Scientific), and centrifuged again ...
-
bioRxiv - Bioengineering 2024Quote: ... Palmitic acid (Palm) and 5(6)- carboxyfluorescein (FAM) were acquired from Acros Organics. Piperidine ...
-
bioRxiv - Developmental Biology 2022Quote: ... or DNAH9 (Primer; Sense: 5’-ACAGGCTGGTGCTGCAGGA-3’, SP6-antisense: 5’-gcgatttaggtgacactatagCAAAATGACGCTGGAGGGG-3’) using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Invitrogen, ThermoFisher Scientific, MA, USA) and a dig-dNTP mix (Roche ...
-
bioRxiv - Biochemistry 2023Quote: ... cyriacigeorgica clinical isolate responsible for pulmonary nocardiosis was used as a template for polymerase chain reaction (PCR) with primers 5’- gatatgcaccacggcctgca-3’ and 5’-acggcgacgaagaagcgga-3’ by using Invitrogen™ Platinum SuperFi II DNA Polymerase (Thermo Fisher Scientific, Illkirch, France). A second PCR was performed on the aforementioned amplicon to amplify the truncated version of NCY-1 with the following forward 5’-ggtaccgagaacctgtacttccagggttcggccgtggccgatccccggttcgccgcactggaaacg-3’and reverse 5’- gtggtgctcgagctaaccgagcacgtcgacgaccgtcctggtcgcgtcggc-3’primers ...
-
bioRxiv - Microbiology 2024Quote: ... The 16S rRNA gene sequence was amplified with a DreamTaq polymerase using genomic DNA as the template and the primers 08F (5′-AGAGTTTGATCCTGGC-3′) and 1504R (5′-TACCTTGTTACGACTT-3′) following the standard instructions of the manufacturer (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was purified using the Master Pure Complete DNA & RNA Purification Kit (Epicentre ...
-
bioRxiv - Cell Biology 2021Quote: ... and incubating for one hour at room temperature with 140 µM Alexa Fluor 488 TFP ester or Alexa Fluor 647 TFP ester (Thermo Fisher). After quenching the reaction with excess Tris/HCl the free label was removed by SEC on a Superdex 200 Increase 10/300 column pre-equilibrated with buffer B.
-
bioRxiv - Biophysics 2020Quote: ... Protein A IgG binding buffer (21001) and Alexa Fluor(tm) 647 NHS Ester (Succinimidyl Ester; A20006) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... followed by staining in 0.5 ml 0.2 M sodium bicarbonate containing 50 mg/ml Alexa Fluor 488 NHS Ester (succinimidyl ester) (Thermo Fisher Scientific #A20100) for 30 min at RT ...
-
bioRxiv - Immunology 2023Quote: ... the different stimulation conditions were subject to barcoding with different concentrations of Pacific Blue NHS ester dye or Pacific Orange succinimidyl ester (both ThermoFisher Scientific). Barcoded conditions were pooled and then subject to further intracellular and surface staining.
-
bioRxiv - Cancer Biology 2024Quote: ... raised dropwise to pH 8.3 using 1.17 M Na2CO3 (pH 11)] were added to the collagen gel before addition of the Alexa Fluor™ 647 NHS Ester (Succinimidyl Ester) dye (A20006, Invitrogen) in 100 μL of PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells (1 × 107) from passage 5-7 were used for transplantation after staining with carboxyfluorescein succinimidyl ester (CSFE) (Invitrogen, Carlsbad, California, USA) on the day of the transplantation ...
-
bioRxiv - Cell Biology 2022Quote: ... 2’,7’-Bis-(2-carboxyethyl)-5-(and-6)-carboxyfluorescein acetoxymethyl ester (BCECF-AM) was purchased from Molecular Probes (Invitrogen, Carlsbad, CA, USA). Fluorescein isothiocyanate (FITC)- and tetramethylrhodamine (TRITC)-conjugated goat anti-mouse and rabbit IgG antibodies were purchased from Jackson ImmunoResearch (West Grove ...
-
bioRxiv - Biophysics 2022Quote: ... EVs were stained with 5-(and-6)-Carboxyfluorescein diacetate succinimidyl ester (CFDA-SE, hereinafter referred as CFSE) (Thermo Fisher, Catalog No. C1157) and separated as described previously [10] ...
-
bioRxiv - Immunology 2023Quote: ... The debris was washed with PBS (5 min, 13000 x g, RT) and labeled for 1 hour with pHrodo Red succinimidyl ester (Thermo Fisher Scientific) with 2 μL of a 10 mM solution per 10×106 cells ...
-
bioRxiv - Immunology 2023Quote: ... The debris was washed with PBS (5 min, 13 000 x g, RT) and labeled for 1 hour with pHrodo Red succinimidyl ester (Thermo Fisher Scientific) with 2 μL of a 10 mM stock per 10×106 cells ...
-
bioRxiv - Molecular Biology 2024Quote: 0.5 × 106 cells from HL-60 were harvested by centrifugation and resuspended in PBS 200 μL with 10 μM 5-(and-6)-chloromethyl-2′,7′—containing Acetyl ester of dichlorodihydrofluorescein diacetate (H2 -DCF, Eugene, Molecular Probes, OR) and 0.4 μg/mL 12-O-tetradecanoylphorbol-13-acetate (TPA ...
-
bioRxiv - Immunology 2021Quote: ... and then stained with cell impermeable SYTOX green nucleic acid stain (3 µM, ThermoFisher Scientific) for 30 min ...
-
bioRxiv - Microbiology 2022Quote: ... The samples were then acidified with 3 drops of 37% hydrochloric acid (Acros Organics, USA) and analyzed ...
-
bioRxiv - Genetics 2022Quote: ... TO-PRO-3 Iodide carbocyanine monomer nucleic acid stain (1:1000, Thermo Fisher, cat# T3605) was used to stain DNA ...