Labshake search
Citations for Thermo Fisher :
951 - 1000 of 10000+ citations for 5 Methylsulfamoylmethyl 1H indole 3 carboxylic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... 1H was performed using an Applied Biosystems 7500 Fast (Thermo Fisher Scientific) with an Applied Biosystems PowerUp SYBR Green Master Mix (Thermo Fisher Scientific) ...
-
bioRxiv - Biophysics 2024Quote: ... monolayers were blocked for 1h using 1wt% BSA (37520, Thermo Fisher Scientific), 22.52 mg/mL glycine (410225 ...
-
bioRxiv - Molecular Biology 2024Quote: ... followed by 1h recovery in DMEM Methionine free media (Gibco, cat# 21013024) (recovery) ...
-
bioRxiv - Biophysics 2021Quote: ... Methyl-PEG4-thiol (MT(PEG)4) was purchased from Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2022Quote: ... 80□μL of N-methyl-N-(trimethylsilyl) trifluoroacetamide□(Thermo Fisher Scientific) and 70□μL ethyl acetate (Sigma-Aldrich ...
-
bioRxiv - Plant Biology 2023Quote: ... and Methyl-PEG-Maleimide Reagent (MM(PEG)24) (Thermo Fisher, 22713). NEM was added to Chlamydomonas cultures growing as indicated in each case to a final concentration of 10 mM ...
-
bioRxiv - Biochemistry 2023Quote: ... methyl tert-butyl ether and 2-propanol were from Thermo Fisher Scientific (Pittsburg ...
-
bioRxiv - Neuroscience 2024Quote: ... and Paraquat (#227320050: Methyl viologen hydrate 98%) was from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... for 1h followed by antibody incubation in 5% Bovine Serum Albumin (BSA) in TBS-T overnight (TfR, 13-6800, ThermoFisher, 1:250; ApoE, Ab947, abcam, 1:500). After three times washing in TBS-T ...
-
bioRxiv - Biochemistry 2020Quote: ... strains were negatively selected against the URA3 marker gene using 1 mg/mL of 5-Fluoroorotic Acid (5-FOA) (Fisher Scientific, F10501-5.0) in SD-plates ...
-
bioRxiv - Immunology 2021Quote: ... on the QuantStudio 5 or QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific). Relative transcript levels were normalized to TATA-binding protein (Tbp ...
-
bioRxiv - Molecular Biology 2021Quote: ... and CAF-1 p60 (5′-AAUCUUGCUCGUCAUACCA-3′) were transfected using RNAi MAX (Invitrogen).
-
bioRxiv - Neuroscience 2020Quote: ... and 0.175 g/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Invitrogen). Alkaline phosphatase staining reaction was proceeded o/n at RT ...
-
bioRxiv - Genomics 2020Quote: ... or a positive control probe 5’-5Alexa488N/(ATA)8TUU (ATA)7-3’ (Invitrogen). Reactions were incubated in a water bath at 37°C for 2 hrs ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 mM succinimidyl 3-(2-pyridyldithio)propionate (SPDP) (Thermo Fisher Scientific, USA) in PBS (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: Non-targeting control (CTRL) (Dharmacon) 5’-UGGUUUACAUGUCGACUAA-3’ KIF18A (Silencer Select s37882 – Ambion)8 5’-UCUCGAUUCUGGAACAAGCAG-3’ RAD51 (Silencer Select s11735 – Ambion ...
-
bioRxiv - Bioengineering 2021Quote: ... or siRNA targeting CTNNB1 (siCTNNB1, targeting sequence 5′- CCACAGCUCCUUCUCUGAGUGGUAA -3’, ThermoFisher, Waltham, MA) were resuspended in 50 μL of Opti-MEM and incubated at room temperature for 30 min ...
-
bioRxiv - Immunology 2022Quote: ... and 5 mM succinimidyl 3-(2-pyridyldithio)propionate (SPDP, Thermo Fisher Scientific, USA) in PBS (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3′-end fluorescent labeling of the RNAs with fluorescein-5-thiosemicarbazide (ThermoFisher Scientific) was done as previously reported (Grozdanov and Stocco ...
-
bioRxiv - Microbiology 2020Quote: ... 3 to 5 colonies were transferred in Mueller-Hinton broth (Thermo Scientific Oxoid) and adjusted to an optical density at 600nm (OD ...
-
bioRxiv - Immunology 2020Quote: Pieces of 3 mm3 tumors were submerged in 5 vol of RNAlater (Invitrogen) (n = 5 samples/group) ...
-
bioRxiv - Developmental Biology 2020Quote: 3 × 106 ESC cells were distributed to 5 12-well dishes (Thermo Scientific) with 5 × 105 mESC cells per well ...
-
bioRxiv - Immunology 2022Quote: ... 5 μl RNA (2ng/μg) and 3 μl of 5x Primer stock (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Amplifications were run on a QuantStudio 3 or 5 thermal cycler (Thermo Fisher) and results were analyzed using the instrument software ...
-
bioRxiv - Cell Biology 2023Quote: ... vector encoding a sgRNA targeting PAC (5′-TGTCGAGCCCGACGCGCGTG-3′) using Lipofectamine 2000 (Invitrogen). GFP positive cells were isolated by FACS two days after infection ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were passaged every 3-5 days using Accutase or ReleSR (ThermoFisher Scientific).
-
bioRxiv - Molecular Biology 2023Quote: ... 3 × 10-4 M MTG and 5% Protein-Free Hybridoma Media II (Gibco).
-
bioRxiv - Cancer Biology 2023Quote: 5’ and 3’ RACE was performed using the GeneRacer kit (Thermo Fisher Scientific), following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... 200 nM MCPH1-5’-CUCUCUGUGUGAAGCACCUdTdT-3’) in serum-Free Opti-MEM medium (Gibco). The transfection controls were set up as above but without adding the siRNA oligos ...
-
bioRxiv - Microbiology 2024Quote: ... 5’-TATTGGTCTCAGGGAGCGAAAGCAGG 3’ using Superscript III according to the manufacturer’s protocol (Invitrogen, #18080400).68 PCRs were performed to amplify and append partial Illumina i5 and i7 adapter sequences across four sub-amplifications of each library to sequence the entire vRNA genome ...
-
bioRxiv - Immunology 2023Quote: ... reconstructed with 5% formic acid (Honeywell|FlukaTM 94318) and desalted with C18 StageTips (Thermo Scientific 87781). Before proceeding with mass spectrometry ...
-
bioRxiv - Molecular Biology 2023Quote: ... fixed 5-µm-thick cardiac sections were retrieved with formic acid 70% solution (Thermo Scientific, #270480010) for twenty minutes at room temperature ...
-
bioRxiv - Bioengineering 2020Quote: ... Bodipy FL c16 (4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Hexadecanoic Acid, Thermofisher) was diluted in sterile RPMI-1640 (Corning ...
-
bioRxiv - Microbiology 2021Quote: ... the drugs were diluted from 0.78-25µM in 200µL of MOPS [3-(N-morpholino) propanesulfonic acid] buffered RPMI 1640 (Life Technologies), pH 7 ...
-
bioRxiv - Microbiology 2023Quote: ... Isopropyl-β-D-thiogalactopyranoside (IPTG) and 3-(N-morpholino) propane sulfonic acid (MOPS) were purchased from Fisher Scientific. MTSES was purchased from Biotium.
-
bioRxiv - Neuroscience 2024Quote: After a wash in Carnoy’s solution (6 ethanol: 3 chloroform: 1 acetic acid; all from Thermo Fisher, USA), used to removed most of the lipids from the section [45] ...
-
bioRxiv - Immunology 2024Quote: 50 000 enriched CD11b+ LCs were seeded and incubated for 10min at 37°C with 2mM Bodipy-C11 (581/591) (4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-undecanoic acid; Invitrogen) in PBS ...
-
bioRxiv - Microbiology 2020Quote: ... Asaia1 (5’-AGC ACC AGT TTC CCG ATG TTA T-3’) and Asaia2 (5’-GAA ATA CCC ATC TCT GGA TA-3’) labeled with Alexa Fluor® 555 (Invitrogen). Tissues were visualized using Nikon ECLIPSE IVi microscope connected to a Nikon DIGITAL SIGHT DS-U3 digital camera.
-
bioRxiv - Cancer Biology 2020Quote: ... and scrambled control mimics (sense 5’ - mCmArUmArUmUrGmCrGmCrGmUrAmUrAmGrUmCrGC - 3’; antisense5’ - /5Phos/rGrCrGrArCrUrArUrArCrGrCrGrCrArArUrArUmGmG rU - 3’; IDT) were reverse transfected at 2nM using Lipofectamine RNAiMax (Life Technologies) according to manufacturer guidelines.
-
bioRxiv - Physiology 2021Quote: ... RNA targeting exon 3 of Ctns (gRNA-ex3 5’-ATCTTTCCAGAATCAACCGTCGG-3’) was produced using the Precision gRNA Synthesis Kit (Thermo Scientific). Online tools RGEN (http://www.rgenome.net/cas-designer/ ...
-
bioRxiv - Immunology 2023Quote: ... and 500 nM each of the forward primer and reverse primer (Table 3) with the following cycling conditions on either QuantStudio 3 or 5 Real-Time PCR systems (Applied Biosystems): 95°C for 2 min ...
-
bioRxiv - Neuroscience 2020Quote: ... a selected cell terminal was puffed for 5 s with a solution containing 3-5 μM FM1-43 (Molecular Probes) and (in mM) ...
-
bioRxiv - Microbiology 2020Quote: The Q577R gp41 change was introduced into pSHIV-AD8-EO via site-directed mutagenesis using 5’p-TCAAGCAGCTCCGGGCAAGAGTCC-3’ (forward) and 5’p-TGCCCCAGACTGTGAGTTGCAACA (reverse) with Platinum SuperFi PCR mastermix (ThermoFisher) as described in the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were then washed 3 x 5 min in PBS and incubated for 5 min in DAPI (Invitrogen, cat# D1306) 1:1000 in PBS ...
-
bioRxiv - Cancer Biology 2022Quote: ... minced skin was incubated at 37°C for 3 – 5 hours in 5 ml of DMEM high glucose (#41965-039; Gibco) supplemented with 10 mg ml-1 collagenase (#C9891 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 1.5 µg of total RNA of each sex were subjected to 5’ and 3’ RACE with a GeneRacer kit (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: Proteins were labeled with succinimidyl ester reactive fluorophores from Molecular Probes (Alexa Fluor™ 647 or DyLight™ 488 NHS Ester ...
-
bioRxiv - Neuroscience 2021Quote: ... 2.3 nl of Alexa Fluor 405 NHS Ester (Thermo Fisher: A30000) or Alexa Fluor 647 10 kDa Dextran (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2020Quote: ... A solution of Alexa Fluor 488 NHS Ester (Invitrogen, Carlsbad, CA) in DMSO (32.5 μL ...
-
bioRxiv - Bioengineering 2020Quote: ... freshly extracted chondrocytes were stained with carboxyfluorescein succinimidyl ester (CFSE) (Invitrogen) prior to hydrogel encapsulation ...