Labshake search
Citations for Thermo Fisher :
651 - 700 of 10000+ citations for 5 Methylsulfamoylmethyl 1H indole 3 carboxylic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... 5 ml MEM Nonessential Amino Acids (Thermo Fisher Scientific, cat. no 11140035), 1 ml 200 mM ascorbic acid (Sigma-Aldrich ...
-
bioRxiv - Physiology 2021Quote: ... + 5% FBS + non-essential amino acids (Gibco, Gaithersburg, MD-Stock# 11140-050), penicillin-streptomycin (Gibco ...
-
bioRxiv - Immunology 2022Quote: ... and were resuspended in 5% acetonitrile with 0.1% formic acid (Thermo Scientific). The resulting peptides were quantified by fluorometric peptide assay kit (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... resuspended in 1 ml of 5% trichloroacetic acid (SA433, Thermo Fisher Scientific) and incubated at 4°C for a minimum of 10 min ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5 ml of MEM non-essential amino acids solution (Thermo Fisher Scientific), 3.5 ml of 2-mercaptoethanol (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2024Quote: ... slides were treated with 5% periodic acid (Thermo Fisher Scientific, MA, USA) for 5 min ...
-
bioRxiv - Bioengineering 2024Quote: ... supplemented with 5% FBS and non-essential amino acids (Life Technologies, 11140050). At 4 days after transfection ...
-
bioRxiv - Cancer Biology 2023Quote: ... Secondary antibody incubation with anti-rabbit-HRP and anti-mouse-HRP was done at room temperature for 1h in 5% milk in TBS-T and the signal developed using an ECL mixture (Life Technologies, 32132). For a detailed list of antibodies see Supplementary Table 2 ...
-
bioRxiv - Cancer Biology 2023Quote: 250’000 Jurkat cells or purified T cells were seeded onto a 24-well plate and transduced at an MOI of 5 via spin-infection for 1h at 800xg and 32°C in 450 µl RPMI-1640 medium (Gibco, #42401-018) containing 50 µl of 100-fold concentrated lentiviruses ...
-
bioRxiv - Developmental Biology 2024Quote: ... aegypti embryos at specified developmental stages (0-1h, 4-5h, 5-6h, 23-24h, 47-48h, and 71-72h) using Trizol® reagent (Ambion by Life Technologies), following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... Samples were incubated at 60 °C for 5 min and then 2.5 μL of 200 mM MMTS (methyl methanethiosulfonate, Thermo Fisher, #23011) was added ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were incubated for 1h with secondary antibodies (Invitrogen). Afterwards ...
-
bioRxiv - Neuroscience 2022Quote: ... or 1h with 10% normal goat serum (Gibco BRL) and 0,4% Triton X-100 (for PLP) ...
-
bioRxiv - Cell Biology 2021Quote: ... phalloidin Texas red (1:100, 1h, Life technologies #T7471) and anti-alpha-Tubulin-FITC (1:200 ...
-
bioRxiv - Neuroscience 2024Quote: ... Two-phase extraction was performed by adding 400 µl of methyl-tert-butyl ether (MTBE): methanol (3:1, v/v; all solvents of High-performance liquid chromatography (HPLC)-grade (Thermo Fisher Scientific, Germany)) ...
-
bioRxiv - Cell Biology 2022Quote: ... while 1,1′-dioctadecyl-3,3,3′,3′-tetramethylindodicarbocyanine-5,5′-disulfonic acid (DilC18) was purchased from Invitrogen. All stock solutions were prepared in chloroform/methanol (2:1 ...
-
bioRxiv - Microbiology 2023Quote: ... Substrate 2,2’-Azinobis [3-ethylbenzothiazoline-6-sulfonic acid]-diammonium salt (ABTS; Thermo Fisher Scientific) was added ...
-
bioRxiv - Genomics 2024Quote: ... fixed in freshly made fixative [3:1 methanol:acetic acid (Fisher Scientific, Waltham, MA, USA)] ...
-
bioRxiv - Neuroscience 2024Quote: Worms were exposed to 20 mM DL-3-hydroxybutyric acid sodium salt (Acros Organics) on NGM agar plates seeded with E ...
-
bioRxiv - Microbiology 2020Quote: ... The modified nucleotide 5-[3-aminoallyl]-2’-deoxyuridine-5’-triphosphate (aminoallyl-dUTP, Thermo Scientific™) was incorporated by PCR using DreamTaq™ DNA Polymerase (Thermo Scientific™) ...
-
bioRxiv - Immunology 2022Quote: ... PBMCs obtained from various time points were pre-labelled with 5 µM of carboxyfluorescein diacetate succinimidyl ester (CFSE; Thermo Fisher Scientific) in PBS with 2.5% FBS for 8 minutes in 37°C water bath ...
-
bioRxiv - Immunology 2021Quote: ... a T-cell proliferation assay was performed by incubating collected mice spleen cells for 7 min at RT with 5 μM Carboxyfluorescein succinimidyl ester (CFSE) (Life Technologies), staining was quenched with FCS and splenocytes cultured at 106 cells/well in 96-well plates for 5 days at 37°C in 5% CO2 with 3 μg/ml of rSp antigen ...
-
bioRxiv - Biochemistry 2022Quote: ICabs A4 and B7 were labelled with NHS-Rhodamine (5/6-carboxy-tetramethyl-rhodamine succinimidyl ester, ThermoFisher Scientific (catalogue no. 46406)) as described by the manufacturer ...
-
bioRxiv - Immunology 2024Quote: ... Washed splenocytes at a concentration of 107 cells/mL in PBS were incubated with 5 μΜ carboxylfluorescein succinimidyl ester (CFSE, V12883, Thermofisher) for 15 min at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... and customized si-KIF4 3′ UTR targeting endogenous KIF4 mRNA 3’-UTR region (5′-GGAAUGAGGUUGUGAUCUUTT-3′) were purchased from Thermo Fisher Scientific.
-
bioRxiv - Microbiology 2020Quote: Beads were labeled with the following N-hydroxysuccinimide ester (NHS)-activated fluorophores: (i) Alexa Fluor 488 NHS ester (Fisher Scientific) (ii ...
-
bioRxiv - Biophysics 2024Quote: ... Alexa Fluor 532 NHS Ester (Succinimidyl Ester) (Cat# A20101MP) and Ionophore A23187 (Cat# J63020.MA) were purchased from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Neuroscience 2020Quote: 20ng of DNA was amplified for PSEN1-Exon6 using forward (5’ GGTTGTGGGACCTGTTAATT 3’) and reverse (5’ CAACAAAGTACATGGCTTTAAATGA 3’) primers with AmpliTaq Gold® 360 PCR Master Mix (Thermofisher, Waltham, MA, USA). Sanger sequencing was performed using BigDye™ Terminator v3.1 Cycle Sequencing Kit (Thermofisher ...
-
bioRxiv - Developmental Biology 2022Quote: ... or DNAH9 (Primer; Sense: 5’-ACAGGCTGGTGCTGCAGGA-3’, SP6-antisense: 5’-gcgatttaggtgacactatagCAAAATGACGCTGGAGGGG-3’) using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Invitrogen, ThermoFisher Scientific, MA, USA) and a dig-dNTP mix (Roche ...
-
bioRxiv - Neuroscience 2022Quote: ... was amplified with specific primers (forward 5’-agtcagaattcatggtgcccactggccag-3’and reverse 5’-AGTCAGGATCCTCAAGCCTTGGCTTCGACTCTT −3’) with fast digest restriction enzymes EcoRl (FD0274, Thermo Fisher Scientific, Massachusetts, USA) and BamHI (FD0054 ...
-
bioRxiv - Cell Biology 2020Quote: Carboxyfluorescein succinimidyl ester (CFSE) dye (Thermo Fisher, UK) was added to human skeletal muscle cells in suspension (1ml HBSS ...
-
bioRxiv - Cell Biology 2020Quote: ... Alexa Fluor 647 NHS ester (A20006, ThermoFisher, USA); CF680 NHS ester (92139 ...
-
bioRxiv - Cell Biology 2020Quote: ... Alexa Fluor 546 NHS ester (A20002, ThermoFisher, USA); DyLight 405 NHS ester (A46400 ...
-
bioRxiv - Bioengineering 2021Quote: ... we used carboxyfluorescein diacetate succinimidyl ester (CFSE, ThermoFisher) to label the cells according to the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2021Quote: ... with Alexa Fluor 488 succinimidyl ester (Thermo Fisher) dissolved in the reaction mixture of PEG-SVA and RGDS ...
-
bioRxiv - Systems Biology 2021Quote: ... or Alexa Fluor 488-NHS ester (Invitrogen A20000) in-house as described previously(32).
-
bioRxiv - Cell Biology 2022Quote: ... ethyl ester (TMRE, final concentration 20nM, Life Technologies) in the relevant medium for 10 min and analyzed by confocal microscopy (Takashima et al. ...
-
bioRxiv - Immunology 2022Quote: ... and the succinimidyl ester of AlexaFluor 488 (ThermoFisher) were used per manufacturer’s protocol for microscopy ...
-
bioRxiv - Biophysics 2022Quote: ... or Alexa Fluor-488 NHS Ester (Molecular Probes), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... Fluorescently labeled (Alexa Fluor 488 NHS ester; Invitrogen) fibrinogen (Sigma ...
-
bioRxiv - Neuroscience 2021Quote: ... Reactive esters were used for labeling (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... and Pacific Orange-NHS-Ester (PO, Molecular Probes) dissolved in dimethyl sulfoxide (DMSO ...
-
bioRxiv - Molecular Biology 2021Quote: ... AF488 (A37570, Alexa Fluor 488 TFP ester, Invitrogen) was diluted to 0.5 mg/mL using dimethyl sulfoxide (D12345 ...
-
bioRxiv - Immunology 2020Quote: ... AlexaFluor 405 or AlexaFluor 647 NHS esters (ThermoFisher) in Sodium Carbonate buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... The dye was Cy3 N-hydroxysuccinimide ester (Invitrogen) dissolved in DMSO and either used immediately or stored at −20°C ...
-
bioRxiv - Immunology 2020Quote: ... Carboxy-S-1-succinimidyl ester (Thermo Fisher Scientific) was coupled to zymosan coated beads (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2022Quote: ... coupled to fluorescein-NHS ester (Thermo Scientific, #46410) for 25 min in the dark at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... or Alexa FluorTM (AF) 647 NHS Ester (Invitrogen) by incubation overnight at 37 ℃ in 0.1M NaHCO3 ...
-
bioRxiv - Cell Biology 2022Quote: ... tetraacetoxymethyl ester (BAPTA-AM, Life Technologies, Brussels, Belgium), 5,5’,6,6’-Tetrafluoro-BAPTA-AM (Interchim ...
-
bioRxiv - Cell Biology 2024Quote: Two different kinds of succinimidyl ester probe (Invitrogen) that contain different fluorescent dye (Texas RedTM and Alexa Flour 488 ...